BMRB Entry 5553

Title:
Solution structure of influenza A virus C4 promoter
Deposition date:
2002-10-10
Original release date:
2003-03-14
Authors:
Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.
Citation:

Citation: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.. "A Single-nucleotide Natural Variation (U4 to C4) in an Influenza A Virus Promoter Exhibits a Large Structural Change: Implications for Differential Viral RNA Synthesis by RNA-dependent RNA Polymerase"  Nucleic Acids Res. 31, 1216-1223 (2003).
PubMed: 12582241

Assembly members:

Assembly members:
C4 promoter of influneza A virus, polymer, 31 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Influenzavirus A   Taxonomy ID: 197911   Superkingdom: Viruses   Kingdom: not available   Genus/species: Influenzavirus A not available

Experimental source:

Experimental source:   Production method: .

Entity Sequences (FASTA):

Entity Sequences (FASTA):
C4 promoter of influneza A virus: AGUAGAAACAAGGCUUCGGC CUGCUUUCGCU

Data sets:
Data typeCount
13C chemical shifts29
15N chemical shifts11
31P chemical shifts18

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1C4 promoter of influneza A virus1

Entities:

Entity 1, C4 promoter of influneza A virus 31 residues - Formula weight is not available

1   AGUAGAAACA
2   AGGCUUCGGC
3   CUGCUUUCGC
4   U

Samples:

sample_1: C4 promoter of influneza A virus 1 mM; H2O 90%; D2O 10%

sample_2: C4 promoter of influneza A virus 1 mM; D2O 99.96%

sample_3: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; H2O 90%; D2O 10%

sample_4: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; D2O 99.96%

sample_cond_1: pH: .; temperature: . .

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablesample_cond_1
DQF-COSYnot availablenot availablesample_cond_1
3D HCCH-COSYnot availablenot availablesample_cond_1

Software:

CNS v1.0 - refinement, structure solution

NMRPipe v2.1 - processing

NMR spectrometers:

  • Varian INOVA 600 MHz