BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4816

Title: Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis   PubMed: 11553808

Authors: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.

Citation: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.. "Structural Features of an Influenza Virus Promoter and Their Implications for Viral RNA Synthesis"  Proc. Natl. Acad. Sci. U.S.A. 98, 10602-10607 (2001).

Assembly members:
INFLUENZA A VIRUS PROMOTER RNA, polymer, 31 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: 11320   Superkingdom: viruses   Kingdom: not available   Genus/species: Influenza virus type A Influenza A virus

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
INFLUENZA A VIRUS PROMOTER RNA: AGUAGAAACAAGGCUUCGGC CUGCUUUUGCU

Data sets:
Data typeCount
13C chemical shifts39
15N chemical shifts23
31P chemical shifts22

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1VRNA1

Entities:

Entity 1, VRNA 31 residues - Formula weight is not available

1   AGUAGAAACA
2   AGGCUUCGGC
3   CUGCUUUUGC
4   U

Samples:

vRNA-H2O: INFLUENZA A VIRUS PROMOTER RNA 2 mM; Na phosphate 10 mM; EDTA 0.1 mM; H2O 90%; D2O 10%

vRNA-D2O: INFLUENZA A VIRUS PROMOTER RNA 2 mM; Na phosphate 10 mM; EDTA 0.1 mM; D2O 99.96%

vRNA-CN-H2O: INFLUENZA A VIRUS PROMOTER RNA, [U-13C; U-15N], 0.4 mM; Na phosphate 10 mM; EDTA 0.1 mM; H2O 90%; D2O 10%

vRNA-CN-D2O: INFLUENZA A VIRUS PROMOTER RNA, [U-13C; U-15N], 0.4 mM; Na phosphate 10 mM; EDTA 0.1 mM; D2O 99.96%

conditions_1: ionic strength: 10 mM; pH: 6.5; temperature: 272 K

conditions_2: ionic strength: 10 mM; pH: 6.5; temperature: 278 K

conditions_3: ionic strength: 10 mM; pH: 6.5; temperature: 294 K

vRNA-conditions_4: ionic strength: 10 mM; pH: 6.5; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
31P-1H HETCORnot availablenot availablenot available

Software:

xwinnmr v2.6 - collection, processing

SPARKY v3.87 - data analysis

X-PLOR v3.1 - refinement

NMR spectrometers:

  • Bruker DRX 400 MHz

Related Database Links: