BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4894

Title: RNA recognition by a staufen double-stranded RNA-binding domain

Authors: Ramos, A.; Grunert, S.; Bycroft, M.; St Johnston, D.; Varani, G.

Citation: Ramos, A.; Grunert, S.; Adams, J.; Micklem, D.; Proctor, M.; Freund, S.; Bycroft, M.; St Johnston, D.; Varani, G.. "RNA recognition by a staufen double-stranded RNA-binding domain"  EMBO J. 19, 997-1009 (2000).

Assembly members:
STAUFEN DOUBLE-STRANDED RNA BINDING DOMAIN, polymer, 90 residues, Formula weight is not available
RNA hairpin, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: fruit fly   Taxonomy ID: 7227   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Drosophila melanogaster

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
STAUFEN DOUBLE-STRANDED RNA BINDING DOMAIN: GSMDEGDKKSPISQVHEIGI KRNMTVHFKVLREEGPAHMK NFITACIVGSIVTEGEGNGK KVSKKRAAEKMLVELQKLPP LTPTKEFIVD
RNA hairpin: GGACAGCUGUCCCUUCGGGG ACAGCUGUCC

Data sets:
Data typeCount
13C chemical shifts345
15N chemical shifts93
1H chemical shifts781
31P chemical shifts4

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1dsRBD31
2RNA22

Entities:

Entity 1, dsRBD3 90 residues - Formula weight is not available

1   GLYSERMETASPGLUGLYASPLYSLYSSER
2   PROILESERGLNVALHISGLUILEGLYILE
3   LYSARGASNMETTHRVALHISPHELYSVAL
4   LEUARGGLUGLUGLYPROALAHISMETLYS
5   ASNPHEILETHRALACYSILEVALGLYSER
6   ILEVALTHRGLUGLYGLUGLYASNGLYLYS
7   LYSVALSERLYSLYSARGALAALAGLULYS
8   METLEUVALGLULEUGLNLYSLEUPROPRO
9   LEUTHRPROTHRLYSGLUPHEILEVALASP

Entity 2, RNA2 30 residues - Formula weight is not available

1   GGACAGCUGU
2   CCCUUCGGGG
3   ACAGCUGUCC

Samples:

sample_1: STAUFEN DOUBLE-STRANDED RNA BINDING DOMAIN mM; RNA hairpin mM

EX-cond_1: pH: 6.8; temperature: 300 K

Experiments:

NameSampleSample stateSample conditions

Software:

No software information available

NMR spectrometers:

  • unknown unknown 0 MHz

Related Database Links:

PDB