BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5007

Title: SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP   PubMed: 11350168

Authors: Flinders, J.; Dieckmann, T.

Citation: Flinders, J.; Dieckmann, T.. "A pH Controlled Conformational Switch In the Cleavage Site of the VS Ribozyme Substrate RNA"  J. Mol. Biol. 308, 665-679 (2001).

Assembly members:
VS Ribozyme, polymer, 30 residues, 9900 Da.

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
VS Ribozyme: GGUGCGAAGGGCGUCGUCGC CCCGAGCGCC

Data sets:
Data typeCount
13C chemical shifts107
15N chemical shifts16
1H chemical shifts177

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1VS RIBOZYME SUBSTRATE RNA1

Entities:

Entity 1, VS RIBOZYME SUBSTRATE RNA 30 residues - 9900 Da.

1   GGUGCGAAGG
2   GCGUCGUCGC
3   CCCGAGCGCC

Samples:

sample_1: VS Ribozyme 1.5 mM

sample_2: VS Ribozyme, [U-98% 13C; U-98% 15N], 1.0 mM

sample_3: VS Ribozyme, [98%-13C; 98%-15N]-Ade, 1.0 mM

sample_cond_1: ionic strength: 5 mM; pH: 6.0; pressure: 1 atm; temperature: 274 K

sample_cond_2: ionic strength: 5 mM; pH*: 6.0; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYnot availablenot availablenot available
2D 1H-13C HSQCnot availablenot availablenot available
2D 1H-13C CT-HSQCnot availablenot availablenot available
2D 1H-15N HMQCnot availablenot availablenot available
2D 1H-1H DQF-COSYnot availablenot availablenot available
3D 13C-1H-1H NOESYnot availablenot availablenot available
3D 1H-13C-1H HCCH-COSYnot availablenot availablenot available

Software:

xwinnmr v2.6 - collection, processing

XEASY v1.3.13 - data analysis

CNS v1.0 - structure solution

NMR spectrometers:

  • Bruker DRX 600 MHz

Related Database Links: