BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5170

Title: NMR Structure and Dynamics of the RNA Binding Site for the Histone mRNA Stem-Loop Binding Protein   PubMed: 11871662

Authors: DeJong, E.; Marzluff, W.; Nikonowicz, E.

Citation: DeJong, E.; Marzluff, W.; Nikonowicz, E.. "NMR Structure and Dynamics of the RNA-binding Site for the Histone mRNA Stem-Loop Binding Protein"  RNA 8, 83-96 (2002).

Assembly members:
Histone mRNA, polymer, 28 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: .

Entity Sequences (FASTA):
Histone mRNA: GGCCCUUUUCAGGGCCCAGG GCCACCCA

Data sets:
Data typeCount
13C chemical shifts128
15N chemical shifts14
1H chemical shifts139

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Histone mRNA1

Entities:

Entity 1, Histone mRNA 28 residues - Formula weight is not available

1   GGCCCUUUUC
2   AGGGCCCAGG
3   GCCACCCA

Samples:

sample_1: Histone mRNA, [U-13C], 2.3 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 100%

sample_2: Histone mRNA, [U-15N], 2.5 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 10%; H2O 90%

sample_3: Histone mRNA, [U-13C], [U-2H]-H5, ; 2, KPi, ; 3, KCl, ; 4, EDTA, ; 5, D2O, ;

sample_4: Histone mRNA 2.8 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 100%

sample_cond_1: pH: 6.8; temperature: 280 K

Experiments:

NameSampleSample stateSample conditions
NOESYnot availablenot availablesample_cond_1
3D 13C-separated NOESYnot availablenot availablesample_cond_1
3D 15N-separated NOESYnot availablenot availablesample_cond_1
DQF-COSYnot availablenot availablesample_cond_1
HetCornot availablenot availablesample_cond_1

Software:

FELIX v980 - processing

X-PLOR v3.851 - refinement

NMR spectrometers:

  • Bruker AMX 500 MHz

Related Database Links: