BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5243

Title: Solution Structure of the 17mer TF1 Binding Site   PubMed: 11955617

Authors: Liu, W.; Vu, H.; Kearns, D.

Citation: Liu, W.; Vu, H.; Kearns, D.. "1H NMR Study of a 17-mer DNA Duplex"  Biochim. Biophys. Acta 1574, 93-99 (2002).

Assembly members:
17mer TF1 Binding Site, polymer, 34 residues, Formula weight is not available

Natural source:   Common Name: Bacillus subtilis   Taxonomy ID: 1423   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Bacillus subtilis

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
17mer TF1 Binding Site: CACTACTCTTTGTAGTGCAC TACAAAGAGTAGTG

Data sets:
Data typeCount
1H chemical shifts363

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
117mer TF1 Binding Site1

Entities:

Entity 1, 17mer TF1 Binding Site 34 residues - Formula weight is not available

1   DCDADCDTDADCDTDCDTDT
2   DTDGDTDADGDTDGDCDADC
3   DTDADCDADADADGDADGDT
4   DADGDTDG

Samples:

sample_1: 17mer TF1 Binding Site 2 mM; phosphate buffer 100 mM; H2O 90%; D2O 10%

sample_cond_1: ionic strength: 0.1 M; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1not availablesample_cond_1
DQF-COSYsample_1not availablesample_cond_1
2D TOCSYsample_1not availablesample_cond_1

Software:

DISCOVER v3.1 - refinement

NMR spectrometers:

  • Bruker DRX 600 MHz

Related Database Links: