BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5349

Title: PBX Homeodomain-DNA complex

Authors: Sprules, Tara; Green, Nancy; Featherstone, Mark; Gehring, Kalle

Citation: Sprules, Tara; Green, Nancy; Featherstone, Mark; Gehring, Kalle. "Lock and Key Binding of the HOX YPWM Peptide to the PBX Homeodomain"  J. Biol. Chem. 278, 1053-1058 (2003).

Assembly members:
PBX homeodomain, polymer, 82 residues, Formula weight is not available
DNA, polymer, 28 residues, Formula weight is not available

Natural source:   Common Name: Mouse   Taxonomy ID: 10090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Mus musculus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
PBX homeodomain: MARRKRRNFNKQATEILNEY FYSHLSNPYPSEEAKEELAK KSGITVSQVSNWFGNKRIRY KKNIGKFQEEANIYAAKTAV TA
DNA: GCGCATGATTGCCCGGGCAA TCATGCGC

Data sets:
Data typeCount
13C chemical shifts317
1H chemical shifts778
15N chemical shifts89

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Extended PBX Homeodomain1
214mer DNA duplex2

Entities:

Entity 1, Extended PBX Homeodomain 82 residues - Formula weight is not available

1   METALAARGARGLYSARGARGASNPHEASN
2   LYSGLNALATHRGLUILELEUASNGLUTYR
3   PHETYRSERHISLEUSERASNPROTYRPRO
4   SERGLUGLUALALYSGLUGLULEUALALYS
5   LYSSERGLYILETHRVALSERGLNVALSER
6   ASNTRPPHEGLYASNLYSARGILEARGTYR
7   LYSLYSASNILEGLYLYSPHEGLNGLUGLU
8   ALAASNILETYRALAALALYSTHRALAVAL
9   THRALA

Entity 2, 14mer DNA duplex 28 residues - Formula weight is not available

1   DGDCDGDCDADTDGDADTDT
2   DGDCDCDCDGDGDGDCDADA
3   DTDCDADTDGDCDGDC

Samples:

sample_1: PBX homeodomain, [U-15N], 1.5 mM; DNA 1.5 mM; DSS 0.2 mM; sodium phosphate 10 mM

sample_2: PBX homeodomain, [U-15N; U-13C], 1.9 mM; DNA 1.9 mM; DSS 0.2 mM; sodium phosphate 10 mM

sample_3: PBX homeodomain 1.4 mM; DNA 1.4 mM; DSS 0.2 mM; sodium phosphate 10 mM

standard_conditions: pH: 7.0; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
15N HSQC-NOESYnot availablenot availablestandard_conditions
13C HSQC-NOESYnot availablenot availablestandard_conditions
HNHAnot availablenot availablestandard_conditions
2D NOESYnot availablenot availablestandard_conditions
CBCACONHnot availablenot availablestandard_conditions
13C HSQCnot availablenot availablestandard_conditions
13C-filtered NOESYnot availablenot availablestandard_conditions

Software:

No software information available

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Varian INOVA 750 MHz

Related Database Links:

BMRB 4357 4358 4359
PDB
DBJ BAA96135 BAA96136 BAB83538 BAF84104 BAG10741
GB AAA21832 AAA36484 AAA36764 AAA60031 AAB71191
PIR B33061
REF NP_001094151 NP_001128334 NP_001179697 NP_001191890 NP_001191892
SP P40424 P41778
TPG DAA32038