BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5371

Title: U6 RNA chemical shifts   PubMed: 11992125

Authors: Butcher, Samuel

Citation: Huppler, Anna; Nikstad, Laura; Allmann, Anne; Brow, David; Butcher, Samuel. "Metal binding and base ionization in the U6 RNA intramolecular stem-loop structure"  Nat. Struct. Biol. 9, 431-435 (2002).

Assembly members:
U6 RNA, polymer, 24 residues, Formula weight is not available

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
U6 RNA: GGUUCCCCUGCAUAAGGAUG AACC

Data sets:
Data typeCount
13C chemical shifts41
15N chemical shifts14
1H chemical shifts211

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U6 RNA 11

Entities:

Entity 1, U6 RNA 1 24 residues - Formula weight is not available

1   GGUUCCCCUG
2   CAUAAGGAUG
3   AACC

Samples:

sample_1: U6 RNA, [U-100% 13C; U-15N], 1.0 mM

cond_1: ionic strength: 0.05 M; pH: 7.0; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
not availablesample_1not availablecond_1

Software:

No software information available

NMR spectrometers:

  • unknown unknown 0 MHz

Related Database Links: