BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5528

Title: Solution structure of the complementary RNA promoter of influenza a virus   PubMed: 12771209

Authors: Park, C.-J.; Bae, S.-H.; Varani, G.; Lee, M.-K.; Choi, B.-S.

Citation: Park, C.-J.; Bae, S.-H.; Lee, M.-K.; Varani, G.; Choi, B.-S.. "Solution Structure of the Influenza A Virus cRNA Promoter: Implications for Differential Recognition of Viral Promoter Structures by RNA-dependent RNA Polymerase"  Nucleic Acids Res. 31, 2824-2832 (2003).

Assembly members:
complementary RNA promoter of influenza virus, polymer, 25 residues, Formula weight is not available

Natural source:   Common Name: influenza A virus   Taxonomy ID: 11320   Superkingdom: not available   Kingdom: not available   Genus/species: influenzavirus A not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
complementary RNA promoter of influenza virus: GGAAGCAGGCUUCGGCCUUG UUUCC

Data sets:
Data typeCount
31P chemical shifts13

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1complementary RNA promoter1

Entities:

Entity 1, complementary RNA promoter 25 residues - Formula weight is not available

1   GGAAGCAGGC
2   UUCGGCCUUG
3   UUUCC

Samples:

sample_1: complementary RNA promoter of influenza virus 1 mM; phosphate buffer 20 mM; EDTA 0.1 mM; H2O 90%; D2O 10%

sample_2: complementary RNA promoter of influenza virus, [U-15N; U-13C], 1 mM; phosphate buffer 20 mM; EDTA 0.1 mM; D2O 100%

sample_cond_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 300 K

sample_cond_2: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 280 K

sample_cond_3: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 290 K

sample_cond_4: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
2D TOCSYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
HETCORnot availablenot availablenot available
3D 13C NOESY-HSQCnot availablenot availablenot available
3D HCCH-COSYnot availablenot availablenot available
3D HCCH-COSY-TOCSYnot availablenot availablenot available

Software:

FELIX v95 - processing

VNMR v6.1c - collection

CNS v1.0 - refinement, structure solution

NMR spectrometers:

  • Varian INOVA 600 MHz

Related Database Links: