BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5632

Title: Solution structure of the p2b hairpin from human telomerase RNA   PubMed: 12525685

Authors: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.

Citation: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.. "Mutations Linked to Dyskeratosis congenita Cause Changes in the Structural Equilibrium in Telomerase RNA"  Proc. Natl. Acad. Sci. U. S. A. 100, 449-454 (2003).

Assembly members:
human telomerase RNA, polymer, 30 residues, 9900 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
human telomerase RNA: GGGCUGUUUUUCUCGCUGAC UUUCAGCCCC

Data sets:
Data typeCount
13C chemical shifts201
15N chemical shifts25
1H chemical shifts262

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1telomerase RNA p2b hairpin1

Entities:

Entity 1, telomerase RNA p2b hairpin 30 residues - 9900 Da.

1   GGGCUGUUUU
2   UCUCGCUGAC
3   UUUCAGCCCC

Samples:

sample_1: human telomerase RNA 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 5%

sample_2: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 100%

sample_3: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM

sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 278 K

sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
3D 13C-separated NOESYnot availablenot availablenot available
3D 13C NOESY-HMQCnot availablenot availablenot available

Software:

xwinnmr v2.6 - processing

AURELIA v3.108 - data analysis

X-PLOR v3.851 - refinement, structure solution

NMR spectrometers:

  • Bruker DRX 500 MHz

Related Database Links: