BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5655

Title: U80G U6 ISL RNA Chemical Shifts   PubMed: 12578359

Authors: Sashital, Dipali; Allmann, Anne; Van Doren, Steve; Butcher, Samuel

Citation: Sashital, D.; Allmann, A.; Van Doren, S.; Butcher, S.. "Structural basis for a lethal mutation in U6 RNA"  Biochemistry 42, 1470-1477 (2003).

Assembly members:
U6 ISL RNA, polymer, 24 residues, Formula weight is not available

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
U6 ISL RNA: GGUUCCCCUGCAUAAGGAGG AACC

Data sets:
Data typeCount
13C chemical shifts138
15N chemical shifts15
1H chemical shifts203

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U80G U6 ISL RNA1

Entities:

Entity 1, U80G U6 ISL RNA 24 residues - Formula weight is not available

1   GGUUCCCCUG
2   CAUAAGGAGG
3   AACC

Samples:

sample_1: U6 ISL RNA, [U-13C; U-15N], 1.5 mM

cond_1: pH: 6.5; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
not availablesample_1not availablecond_1

Software:

CNS v1.1 -

NMR spectrometers:

  • Bruker DMX 400 MHz
  • Bruker DMX 500 MHz
  • Bruker DMX 600 MHz
  • Bruker DMX 750 MHz

Related Database Links: