BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5773

Title: Solution structure of HIV-1 Stem Loop SL1   PubMed: 12559920

Authors: Lawrence, D.; Stover, C.; Noznitsky, J.; Wu, Z.; Summers, M.

Citation: Lawrence, D.; Stover, C.; Noznitsky, J.; Wu, Z.; Summers, M.. "Structure of the Intact Stem and Bulge of HIV-1 Psi-RNA Stem Loop SL1"  J. Mol. Biol. 326, 529-542 (2003).

Assembly members:
HIV-1 Stem loop SL1, polymer, 36 residues, 12363 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
HIV-1 Stem loop SL1: GGACUCGGCUUGCUGGAGAC GGCAAGAGGCGAGUCC

Data sets:
Data typeCount
13C chemical shifts237
1H chemical shifts272

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1HIV-1 STEM LOOP SL1 MONOMERIC RNA1

Entities:

Entity 1, HIV-1 STEM LOOP SL1 MONOMERIC RNA 36 residues - 12363 Da.

1   GGACUCGGCU
2   UGCUGGAGAC
3   GGCAAGAGGC
4   GAGUCC

Samples:

sample_1: HIV-1 Stem loop SL1, [U-13C; U-15N], 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%

sample_2: HIV-1 Stem loop SL1, [13C, 15N]-cytidine, 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%

sample_3: HIV-1 Stem loop SL1 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%

sample_4: HIV-1 Stem loop SL1, [U-13C; U-15N], 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; Pf1 phage 17 mg/ml

sample_5: HIV-1 Stem loop SL1 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 10%; H2O 90%

sample_cond_1: pH: 6.0; pressure: 1 atm; temperature: 308 K

sample_cond_2: pH: 8.0; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
3D 13C-separated NOESYnot availablenot availablenot available
4D 13C-separated NOESYnot availablenot availablenot available
3D 13C-separated ROESYnot availablenot availablenot available
IPAP H-COUPLED CT-HSQCnot availablenot availablenot available
2D NOESYnot availablenot availablenot available
2D ROESYnot availablenot availablenot available

Software:

xwinnmr v2.6 - collection

NMRPipe v2.1 - processing

NMRView v5.0.3 - data analysis

DYANA v1.5 - refinement

NMR spectrometers:

  • Bruker DMX 600 MHz
  • Bruker DMX 800 MHz

Related Database Links: