BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5919

Title: The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts   PubMed: 12527295

Authors: Vallurupalli, Pramodh; Moore, Peter

Citation: Vallurupalli, Pramodh; Moore, Peter. "The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts"  J. Mol. Biol. 325, 843-856 (2003).

Assembly members:
Loop E of 5S rRNA from spinach chloroplasts, polymer, 42 residues, 14468 Da.

Natural source:   Common Name: Spinach   Taxonomy ID: 3562   Superkingdom: Eukaryota   Kingdom: Viridiplantae   Genus/species: Spinacia oleracea

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
Loop E of 5S rRNA from spinach chloroplasts: GGGUGACGAUACUGUAGGCG AGAGCCUGCGGAAAAAUAGC CC

Data sets:
  • assigned_chemical_shifts
Data typeCount
13C chemical shifts110
15N chemical shifts20
1H chemical shifts253

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Loop E of 5S rRNA from spinach chloroplasts1

Entities:

Entity 1, Loop E of 5S rRNA from spinach chloroplasts 42 residues - 14468 Da.

1   GGGUGACGAU
2   ACUGUAGGCG
3   AGAGCCUGCG
4   GAAAAAUAGC
5   CC

Samples:

Sample_1: Loop E of 5S rRNA from spinach chloroplasts 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 10%; H2O 90%

Sample_2: Loop E of 5S rRNA from spinach chloroplasts 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 100%

Sample_3: Loop E of 5S rRNA from spinach chloroplasts, [U->90% 13C; U->90% 15N], 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 10%; H2O 90%

Sample_4: Loop E of 5S rRNA from spinach chloroplasts, [U->90% 13C; U->90% 15N], 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 100%

Cond_1: pH: 6.5; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H-15NHSQCnot availablenot availablenot available
1H-13CHSQCnot availablenot availablenot available
1H-13CNOESY-HMQCnot availablenot availablenot available
HCcH COSYnot availablenot availablenot available
Relay HCcH COSYnot availablenot availablenot available
Double Relay HCcH COSYnot availablenot availablenot available
IPAP HSQCnot availablenot availablenot available
IPAP HCcH COSYnot availablenot availablenot available
IPAP Relay HCcH COSYnot availablenot availablenot available
NOESYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available

Software:

FELIX -

SPARKY -

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian UnityPlus 500 MHz
  • Varian INOVA 500 MHz

Related Database Links: