BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5962

Title: Chemical shifts assignments of domain 5 of the ai5gamma group II intron   PubMed: 14745440

Authors: Sigel, Roland; Sashital, Dipali; Abramowitz, Dana; Palmer, Arthur; Butcher, Samuel; Pyle, Anna Marie

Citation: Sigel, Roland; Sashital, Dipali; Abramowitz, Dana; Palmer, Arthur; Butcher, Samuel; Pyle, Anna Marie. "Solution structure of domain 5 of a group II intron ribozyme reveals a new RNA motif"  Nat. Struct. Mol. Biol. 11, 187-192 (2004).

Assembly members:
Domain 5, polymer, 36 residues, 12297 Da.

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
Domain 5: GGAGCCGUAUGCGAUGAAAG UCGCACGUACGGUUCC

Data sets:
Data typeCount
13C chemical shifts97
15N chemical shifts41
1H chemical shifts272

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1wildtype domain 5 hairpin1

Entities:

Entity 1, wildtype domain 5 hairpin 36 residues - 12297 Da.

1   GGAGCCGUAU
2   GCGAUGAAAG
3   UCGCACGUAC
4   GGUUCC

Samples:

sample_1: Domain 5, [U-13C; U-15N], 0.4 – 0.7 mM; KCl 100 mM; Edta 10 micM

cond_1: ionic strength: 0.11 mM; pH: 6.7; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
1H,1H NOESYsample_1not availablecond_1
3D-13C separated NOESYsample_1not availablecond_1
2D 1H-13C HSQCsample_1not availablecond_1
2D 1H-1H TOCSYsample_1not availablecond_1
3D 1H-13C-1H HCCH TOCSYsample_1not availablecond_1
3D 1H-13C-1H HCCH COSYsample_1not availablecond_1
2D 2JHN HNN-COSYsample_1not availablecond_1

Software:

xwinnmr v2.6 - processing

SPARKY v3 - data analysis

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker DMX 500 MHz
  • Bruker DMX 750 MHz

Related Database Links: