BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6062

Title: Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929   PubMed: 15317975

Authors: Cabello-Villegas, Javier; Guiles, Keith; Soto, Ana; Yu, Ping; Beemon, Karen; Wang, Yun-Xing

Citation: Cabello-Villegas, Javier; Giles, Keith; Soto, Ana; Yu, Ping; Mougin, A.; Beemon, Karen; Wang, Yun-Xing. "Solution structure of the pseudo-5' splice site of a retroviral splicing suppressor"  RNA 10, 1388-1398 (2004).

Assembly members:
RNA stem-loop, polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: Rous sarcoma virus   Taxonomy ID: 11886   Superkingdom: Viruses   Kingdom: not available   Genus/species: alpharetrovirus Rous sarcoma virus

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA stem-loop: GGGGAGUGGUUUGUAUCCUU CCC

Data sets:
Data typeCount
13C chemical shifts153
15N chemical shifts15
31P chemical shifts17

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1NRS231

Entities:

Entity 1, NRS23 23 residues - Formula weight is not available

1   GGGGAGUGGU
2   UUGUAUCCUU
3   CCC

Samples:

Sample_1: RNA stem-loop, [U-13C; U-15N], 1.2 mM; sodium phosphate buffer 10 mM; NaCl 25 mM

condition_1: pH: 6.5; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
1H-13C NOESY-HSQCnot availablenot availablenot available
2D NOESYnot availablenot availablenot available
15N/1H HMQCnot availablenot availablenot available
HCCH-TOCSYnot availablenot availablenot available
HCCH-COSYnot availablenot availablenot available
HNCCCHnot availablenot availablenot available
HCPnot availablenot availablenot available

Software:

NMRDraw - Spectra analysis

NMRView - Spectra analysis

NMRPipe - Spectra processing

NMR spectrometers:

  • Varian INOVA 800 MHz
  • Varian INOVA 600 MHz
  • Varian INOVA 500 MHz
  • Bruker DRX 500 MHz

Related Database Links: