BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 15869

Title: NMR Assignments of HIV-2 TAR RNA   PubMed: 19636896

Authors: Carlomagno, Teresa; Amata, Irene; Williamson, James

Citation: Carlomagno, Teresa; Amata, Irene; Williamson, James; Hennig, Mirko. "NMR Assignments of HIV-2 TAR RNA"  Biomol. NMR Assignments 2, 167-169 (2008).

Assembly members:
HIV-2_TAR, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: HIV   Taxonomy ID: 11709   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus Human immunodeficiency virus 2

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
HIV-2_TAR: GGCCAGAUUGAGCCUGGGAG CUCUCUGGCC

Data sets:
Data typeCount
13C chemical shifts270
15N chemical shifts47
1H chemical shifts272
31P chemical shifts29

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1subunit 11

Entities:

Entity 1, subunit 1 30 residues - Formula weight is not available

nucleotides 16-46 are numbered consecutively; bulged residue 24 is omitted to allow for comparison with HIV-1 TAR

1   GGCCAGAUUG
2   AGCCUGGGAG
3   CUCUCUGGCC

Samples:

sample_1: HIV-2 TAR, [U-99% 13C; U-99% 15N], 1 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_2: HIV-2 TAR, [U-99% 13C; U-99% 15N], 1 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; D2O, [U-100% 2H], 100%

sample_3: HIV-2 TAR 2 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 0.05 M; pH: 6.4; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 0.05 M; pH: 6.4; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
3D HCCH-COSYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_3isotropicsample_conditions_2
2D DQF-COSYsample_3isotropicsample_conditions_2

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

FELIX, Accelrys Software Inc. - chemical shift assignment

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Bruker DRX 800 MHz

Related Database Links: