BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19018

Title: NMR structure of E. coli ribosomela decoding site with apramycin   PubMed: 23416053

Authors: Puglisi, Joseph; Tsai, Albert; Marshall, R. Andrew; Viani, Elisabetta

Citation: Tsai, Albert; Uemura, Sotaro; Johansson, Magnus; Puglisi, Elisabetta Viani; Marshall, R. Andrew; Aitken, Colin Echeverria; Korlach, Jonas; Ehrenberg, Mans; Puglisi, Joseph. "The impact of aminoglycosides on the dynamics of translation elongation."  Cell Rep. 3, 497-508 (2013).

Assembly members:
RNA, polymer, 27 residues, 132.116 Da.
APRAMYCIN, non-polymer, 539.577 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA: GGCGUCACACCUUCGGGUGA AGUCGCC

Data sets:
Data typeCount
13C chemical shifts256
15N chemical shifts101
1H chemical shifts262
31P chemical shifts27

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1
2APRAMYCIN_12
3APRAMYCIN_22
4APRAMYCIN_32

Entities:

Entity 1, RNA 27 residues - 132.116 Da.

1   GGCGUCACAC
2   CUUCGGGUGA
3   AGUCGCC

Entity 2, APRAMYCIN_1 - C21 H41 N5 O11 - 539.577 Da.

1   AM2

Samples:

sample_1: RNA, [U-100% 13C; U-100% 15N], 0.5 – 1 mM; APRAMYCIN0.5 – 1 mM; H2O 90%; D2O 10%

sample_2: RNA0.5 – 1 mM; APRAMYCIN0.5 – 1 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 0.05 M; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
3D HCCH-COSYsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_1isotropicsample_conditions_1

Software:

X-PLOR, Brunger - refinement

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: