BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25604

Title: Solution structure of a double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA   PubMed: 26165594

Authors: Codutti, Luca; Leppek, Katrin; Zalesak, Jan; Windeisen, Volker; Masiewicz, Pawel; Stoecklin, Georg; Carlomagno, Teresa

Citation: Codutti, Luca; Leppek, Katrin; Zalesak, Jan; Windeisen, Volker; Masiewicz, Pawel; Stoecklin, Georg; Carlomagno, Teresa. "A Distinct, Sequence-Induced Conformation Is Required for Recognition of the Constitutive Decay Element RNA by Roquin"  Structure 23, 1437-1447 (2015).

Assembly members:
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3'), polymer, 23 residues, 7343.398 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
RNA_(5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3'): GCAUGUUUAGUGUCUAAACG GUU

Data sets:
Data typeCount
13C chemical shifts151
1H chemical shifts180
31P chemical shifts22

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3')1

Entities:

Entity 1, RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') 23 residues - 7343.398 Da.

1   GCAUGUUUAG
2   UGUCUAAACG
3   GUU

Samples:

sample_1: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.35 ± .05 mM; sodium phosphate 20 ± 5 mM

sample_2: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.35 ± 0.05 mM; sodium phosphate 20 ± 5 mM

sample_3: RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3'), [U-100% 13C; U-100% 15N], 0.35 ± .05 mM; sodium phosphate 20 ± 5 mM; Pf1 phage 30 mg/mL

sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 300 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
immino-1H-1H NOESYsample_2isotropicsample_conditions_1
3D-HCCH-COSY-TOCSYsample_1isotropicsample_conditions_1
3D HsCNb/HbCNbsample_1isotropicsample_conditions_1
2D HNN-COSYsample_2isotropicsample_conditions_1
3D 13C-edited NOESYsample_1isotropicsample_conditions_1
2D COSYsample_1isotropicsample_conditions_1
1H-31P HET-COR(P,H-COSY-H,C-HMQC)sample_1isotropicsample_conditions_1
T1-13C-EDIT relaxationsample_1isotropicsample_conditions_1
T1rho-13C-EDIT relaxationsample_1isotropicsample_conditions_1
13C-base edited IPAPsample_3anisotropicsample_conditions_1
13C-sugar edited IPAPsample_3anisotropicsample_conditions_1

Software:

ARIA v1.2, Linge, O'Donoghue and Nilges - refinement, structure solution

CCPN_Analysis v2.3, CCPN - chemical shift assignment

TOPSPIN v3.0, Bruker Biospin - collection

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: