BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25759

Title: Solution structure for quercetin complexed with c-myc G-quadruplex DNA

Authors: Kumar, Amit; Tawani, Arpita

Citation: Kumar, Amit; Tawani, Arpita. "Solution structure for quercetin complexed with c-myc G-quadruplex DNA"  Not known ., .-..

Assembly members:
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*GP*(DN)P*(DN))-3'), polymer, 26 residues, 7862.206 Da.
entity_QUE, non-polymer, 302.236 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*GP*(DN)P*(DN))-3'): TGAGGGTGGTGAGGGTGGGG AAGGXX

Data sets:
Data typeCount
1H chemical shifts57

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*GP*(DN)P*(DN))-3')1
2entity_QUE2

Entities:

Entity 1, DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*GP*(DN)P*(DN))-3') 26 residues - 7862.206 Da.

1   DTDGDADGDGDGDTDGDGDT
2   DGDADGDGDGDTDGDGDGDG
3   DADADGDGDNDN

Entity 2, entity_QUE - C15 H10 O7 - 302.236 Da.

1   QUE

Samples:

sample_1: DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*GP*(DN)P*(DN))-3') 2.3 mM; H2O 90%; D2O, [U-2H], 10%

sample_conditions_1: ionic strength: 100 mM; pH: 7.1; pressure: 1 atm; temperature: 295 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

CNS, Brunger A. T. et.al. - refinement

NMR spectrometers:

  • Bruker Avance 400 MHz

Related Database Links: