BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25888

Title: 1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break   PubMed: 26626479

Authors: Neuhaus, David; Eustermann, Sebastian; Yang, Ji-Chun; Wu, Wing-Fung

Citation: Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura; Riccio, Amanda; Pascal, John; Neuhaus, David. "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1"  Mol. Cell 60, 742-754 (2015).

Assembly members:
F1F2, polymer, 214 residues, 24106.734 Da.
DNA_(45-MER), polymer, . residues, 13871.971 Da.
entity_ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
F1F2: MAESSDKLYRVEYAKSGRAS CKKCSESIPKDSLRMAIMVQ SPMFDGKVPHWYHFSCFWKV GHSIRHPDVEVDGFSELRWD DQQKVKKTAEAGGVTGKGQD GIGSKAEKTLGDFAAEYAKS NRSTCKGCMEKIEKGQVRLS KKMVDPEKPQLGMIDRWYHP GCFVKNREELGFRPEYSASQ LKGFSLLATEDKEALKKQLP GVKSEGKRKGDEVD
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA GCTCGCGGTCAGCTTGCTGA CCGCG

Data sets:
Data typeCount
13C chemical shifts272
15N chemical shifts396
1H chemical shifts896

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1F1F21
2DNA (45-MER)2
3ZN, 13
4ZN, 23

Entities:

Entity 1, F1F2 214 residues - 24106.734 Da.

1   METALAGLUSERSERASPLYSLEUTYRARG
2   VALGLUTYRALALYSSERGLYARGALASER
3   CYSLYSLYSCYSSERGLUSERILEPROLYS
4   ASPSERLEUARGMETALAILEMETVALGLN
5   SERPROMETPHEASPGLYLYSVALPROHIS
6   TRPTYRHISPHESERCYSPHETRPLYSVAL
7   GLYHISSERILEARGHISPROASPVALGLU
8   VALASPGLYPHESERGLULEUARGTRPASP
9   ASPGLNGLNLYSVALLYSLYSTHRALAGLU
10   ALAGLYGLYVALTHRGLYLYSGLYGLNASP
11   GLYILEGLYSERLYSALAGLULYSTHRLEU
12   GLYASPPHEALAALAGLUTYRALALYSSER
13   ASNARGSERTHRCYSLYSGLYCYSMETGLU
14   LYSILEGLULYSGLYGLNVALARGLEUSER
15   LYSLYSMETVALASPPROGLULYSPROGLN
16   LEUGLYMETILEASPARGTRPTYRHISPRO
17   GLYCYSPHEVALLYSASNARGGLUGLULEU
18   GLYPHEARGPROGLUTYRSERALASERGLN
19   LEULYSGLYPHESERLEULEUALATHRGLU
20   ASPLYSGLUALALEULYSLYSGLNLEUPRO
21   GLYVALLYSSERGLUGLYLYSARGLYSGLY
22   ASPGLUVALASP

Entity 2, DNA (45-MER) - 13871.971 Da.

1   DGDCDTDGDGDCDTDTDCDG
2   DTDADADGDADADGDCDCDA
3   DGDCDTDCDGDCDGDGDTDC
4   DADGDCDTDTDGDCDTDGDA
5   DCDCDGDCDG

Entity 3, ZN, 1 - Zn - 65.409 Da.

1   ZN

Samples:

sample_1: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_2: PARP-1 1-214, [U-15N; U-13C; U-70% 2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_3: PARP-1 1-214, [U-98% 2H; U-98% 15N], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_4a: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_4b: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_5: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_6: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_7: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_8: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_9: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_10: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_11: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

sample_1_D2O: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

bound_F1F2_high_salt: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 uM; sodium chloride 200 mM; H2O 95%; D2O, [U-2H], 5%

sample_conditions_1: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

sample_conditions_3: ionic strength: 0.25 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N TROSYsample_1isotropicsample_conditions_1
2D 1H-13C HMQCsample_1isotropicsample_conditions_1
TROSY-NHCACB (optimized for CB)sample_1isotropicsample_conditions_1
TROSY-HNCAsample_1isotropicsample_conditions_1
TROSY-HN(CO)CAsample_1isotropicsample_conditions_1
2D 1H-15N TROSYsample_2isotropicsample_conditions_1
2D 1H-13C HMQCsample_2isotropicsample_conditions_1
TROSY-HNCAsample_2isotropicsample_conditions_1
TROSY-HN(CO)CAsample_2isotropicsample_conditions_1
2D 1H-15N TROSYsample_3isotropicsample_conditions_1
3D 1H-13C-1H NOESY-HMQCsample_4aisotropicsample_conditions_1
HMCM(CG)CBCAsample_4bisotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
3D 13C-13C-1H HMQC-NOESY-HMQCsample_5isotropicsample_conditions_1
3D 1H-13C-1H NOESY-HMQCsample_5isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_6isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2sample_7isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1)sample_7isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2sample_8isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1)sample_8isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1)sample_9isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2sample_10isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_11isotropicsample_conditions_1
2D 1H-1H NOESY filtered to accept 13C-1H in w2sample_11isotropicsample_conditions_1
2D 1H-1H NOESYsample_1_D2Oisotropicsample_conditions_1
2D 1H-15N TROSYbound_F1F2_high_saltisotropicsample_conditions_3

Software:

X-PLOR_NIH v2.28, Schwieters, Kuszewski, Tjandra and Clore - structure solution

SPARKY v3.115, Goddard - chemical shift assignment

TOPSPIN v2.1, Bruker Biospin - processing

Analysis v2.4.1, CCPN - chemical shift assignment, data analysis

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMR spectrometers:

  • Bruker Avance I 800 MHz
  • Bruker Avance II+ 700 MHz
  • Bruker DMX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: