BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25890

Title: 1H chemical shift assignments for 45 nucleotide DNA dumbbell (model for single-strand break with one-nucleotide gap)   PubMed: 26626479

Authors: Neuhaus, David; Eustermann, Sebastian; Yang, Ji-Chun; Wu, Wing-Fung

Citation: Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura; Riccio, Amanda; Pascal, John; Neuhaus, David. "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1"  Mol. Cell 60, 742-754 (2015).

Assembly members:
DNA_(45-MER), polymer, 45 residues, 13871.971 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA GCTCGCGGTCAGCTTGCTGA CCGCG

Data sets:
Data typeCount
1H chemical shifts340

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (45-MER)1

Entities:

Entity 1, DNA (45-MER) 45 residues - 13871.971 Da.

1   DGDCDTDGDGDCDTDTDCDG
2   DTDADADGDADADGDCDCDA
3   DGDCDTDCDGDCDGDGDTDC
4   DADGDCDTDTDGDCDTDGDA
5   DCDCDGDCDG

Samples:

free_DNA_D2O: DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%

free_DNA_H2O: DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%

sample_conditions_1: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

sample_conditions_2: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

sample_conditions_3: ionic strength: 0.25 M; pH: 7.2; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYfree_DNA_D2Oisotropicsample_conditions_1
2D 1H-1H NOESYfree_DNA_D2Oisotropicsample_conditions_1
2D 1H-1H TOCSYfree_DNA_H2Oisotropicsample_conditions_2
2D 1H-1H NOESYfree_DNA_H2Oisotropicsample_conditions_2

Software:

X-PLOR_NIH v2.28, Schwieters, Kuszewski, Tjandra and Clore - structure solution

SPARKY v3.115, Goddard - chemical shift assignment

TOPSPIN v2.1, Bruker Biospin - processing

Analysis v2.4.1, CCPN - chemical shift assignment, data analysis

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMR spectrometers:

  • Bruker Avance I 800 MHz
  • Bruker Avance II+ 700 MHz
  • Bruker DMX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: