BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25891

Title: 1H, 13C and 15N chemical shift assignments for PARP-1 F1F2F3 domains in complex with a DNA single-strand break   PubMed: 26626479

Authors: Neuhaus, David; Eustermann, Sebastian; Yang, Ji-Chun; Wu, Wing-Fung

Citation: Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura; Riccio, Amanda; Pascal, John; Neuhaus, David. "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1"  Mol. Cell 60, 742-754 (2015).

Assembly members:
PARP-1_1-362, polymer, 362 residues, 24106.734 Da.
ZINC ION, non-polymer, 65.409 Da.
DNA_(45-MER), polymer, 45 residues, 13871.971 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
PARP-1_1-362: MAESSDKLYRVEYAKSGRAS CKKCSESIPKDSLRMAIMVQ SPMFDGKVPHWYHFSCFWKV GHSIRHPDVEVDGFSELRWD DQQKVKKTAEAGGVTGKGQD GIGSKAEKTLGDFAAEYAKS NRSTCKGCMEKIEKGQVRLS KKMVDPEKPQLGMIDRWYHP GCFVKNREELGFRPEYSASQ LKGFSLLATEDKEALKKQLP GVKSEGKRKGDEVDGVDEVA KKKSKKEKDKDSKLEKALKA QNDLIWNIKDELKKVCSTND LKELLIFNKQQVPSGESAIL DRVADGMVFGALLPCEECSG QLVFKSDAYYCTGDVTAWTK CMVKTQTPNRKEWVTPKEFR EISYLKKLKVKKQDRIFPPE TS
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA GCTCGCGGTCAGCTTGCTGA CCGCG

Data sets:
Data typeCount
13C chemical shifts348
15N chemical shifts335
1H chemical shifts335

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1PARP-1_1-3621
2DNA (45-MER)3
3ZN12
4ZN22
5ZN32

Entities:

Entity 1, PARP-1_1-362 362 residues - 24106.734 Da.

1   METALAGLUSERSERASPLYSLEUTYRARG
2   VALGLUTYRALALYSSERGLYARGALASER
3   CYSLYSLYSCYSSERGLUSERILEPROLYS
4   ASPSERLEUARGMETALAILEMETVALGLN
5   SERPROMETPHEASPGLYLYSVALPROHIS
6   TRPTYRHISPHESERCYSPHETRPLYSVAL
7   GLYHISSERILEARGHISPROASPVALGLU
8   VALASPGLYPHESERGLULEUARGTRPASP
9   ASPGLNGLNLYSVALLYSLYSTHRALAGLU
10   ALAGLYGLYVALTHRGLYLYSGLYGLNASP
11   GLYILEGLYSERLYSALAGLULYSTHRLEU
12   GLYASPPHEALAALAGLUTYRALALYSSER
13   ASNARGSERTHRCYSLYSGLYCYSMETGLU
14   LYSILEGLULYSGLYGLNVALARGLEUSER
15   LYSLYSMETVALASPPROGLULYSPROGLN
16   LEUGLYMETILEASPARGTRPTYRHISPRO
17   GLYCYSPHEVALLYSASNARGGLUGLULEU
18   GLYPHEARGPROGLUTYRSERALASERGLN
19   LEULYSGLYPHESERLEULEUALATHRGLU
20   ASPLYSGLUALALEULYSLYSGLNLEUPRO
21   GLYVALLYSSERGLUGLYLYSARGLYSGLY
22   ASPGLUVALASPGLYVALASPGLUVALALA
23   LYSLYSLYSSERLYSLYSGLULYSASPLYS
24   ASPSERLYSLEUGLULYSALALEULYSALA
25   GLNASNASPLEUILETRPASNILELYSASP
26   GLULEULYSLYSVALCYSSERTHRASNASP
27   LEULYSGLULEULEUILEPHEASNLYSGLN
28   GLNVALPROSERGLYGLUSERALAILELEU
29   ASPARGVALALAASPGLYMETVALPHEGLY
30   ALALEULEUPROCYSGLUGLUCYSSERGLY
31   GLNLEUVALPHELYSSERASPALATYRTYR
32   CYSTHRGLYASPVALTHRALATRPTHRLYS
33   CYSMETVALLYSTHRGLNTHRPROASNARG
34   LYSGLUTRPVALTHRPROLYSGLUPHEARG
35   GLUILESERTYRLEULYSLYSLEULYSVAL
36   LYSLYSGLNASPARGILEPHEPROPROGLU
37   THRSER

Entity 3, DNA (45-MER) 45 residues - 13871.971 Da.

1   DGDCDTDGDGDCDTDTDCDG
2   DTDADADGDADADGDCDCDA
3   DGDCDTDCDGDCDGDGDTDC
4   DADGDCDTDTDGDCDTDGDA
5   DCDCDGDCDG

Entity 2, ZN1 - Zn - 65.409 Da.

1   ZN

Samples:

sample_1: PARP-1_1-362, [U-13C; U-15N; U-2H]-1_214, [natural abundance]-215_362, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%; sodium chloride 200 mM

sample_2: PARP-1_1-362, [natural abundance]-1_214, [U-13C; U-15N; U-2H]-215_362, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%; sodium chloride 200 mM

sample_3: PARP-1_1-362, [U-13C; U-15N; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%; sodium chloride 200 mM

sample_conditions_1: ionic strength: 0.25 M; pH: 7.2; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N TROSYsample_1isotropicsample_conditions_1
3D TROSY-HNCAsample_1isotropicsample_conditions_1
2D 1H-15N TROSYsample_2isotropicsample_conditions_1
3D TROSY-HNCAsample_2isotropicsample_conditions_1
2D 1H-15N TROSYsample_3isotropicsample_conditions_1
3D TROSY-HNCAsample_3isotropicsample_conditions_1

Software:

SPARKY v3.115, Goddard - chemical shift assignment

TOPSPIN v2.1, Bruker Biospin - processing

Analysis v2.4.1, CCPN - chemical shift assignment, data analysis

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

NMR spectrometers:

  • Bruker Avance I 800 MHz
  • Bruker Avance II+ 700 MHz
  • Bruker DMX 600 MHz
  • Bruker DRX 500 MHz

Related Database Links: