BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 26731

Title: Structural and dynamics studies of Pax5 reveal asymmetry in stability and DNA binding by the Paired domain   PubMed: 27067111

Authors: Perez-Borrajero, Cecilia; McIntosh, Lawrence

Citation: Perez-Borrajero, Cecilia; Okon, Mark; McIntosh, Lawrence. "Structural and Dynamics Studies of Pax5 Reveal Asymmetry in Stability and DNA Binding by the Paired Domain"  J. Mol. Biol. 428, 2372-2391 (2016).

Assembly members:
Paired_domain_of_Pax5, polymer, 151 residues, Formula weight is not available
DNA_1, polymer, 25 residues, Formula weight is not available
DNA_2, polymer, 25 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
Paired_domain_of_Pax5: GHMDLEKNYPTPRTSRTGHG GVNQLGGVFVNGRPLPDVVR QRIVELAHQGVRPCDISRQL RVSHGCVSKILGRYYETGSI KPGVIGGSKPKVATPKVVEK IAEYKRQNPTMFAWEIRDRL LAERVCDNDTVPSVSSINRI IRTKVQQPPNQ
DNA_1: CGGTGGTCACGCCTCAGTGC CCCAT
DNA_2: GCCACCAGTGCGGAGTCACG GGGTA

Data sets:
Data typeCount
13C chemical shifts424
15N chemical shifts135
1H chemical shifts135

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Paired domain of Pax51
2DNA_12
3DNA_23

Entities:

Entity 1, Paired domain of Pax5 151 residues - Formula weight is not available

1   GLYHISMETASPLEUGLULYSASNTYRPRO
2   THRPROARGTHRSERARGTHRGLYHISGLY
3   GLYVALASNGLNLEUGLYGLYVALPHEVAL
4   ASNGLYARGPROLEUPROASPVALVALARG
5   GLNARGILEVALGLULEUALAHISGLNGLY
6   VALARGPROCYSASPILESERARGGLNLEU
7   ARGVALSERHISGLYCYSVALSERLYSILE
8   LEUGLYARGTYRTYRGLUTHRGLYSERILE
9   LYSPROGLYVALILEGLYGLYSERLYSPRO
10   LYSVALALATHRPROLYSVALVALGLULYS
11   ILEALAGLUTYRLYSARGGLNASNPROTHR
12   METPHEALATRPGLUILEARGASPARGLEU
13   LEUALAGLUARGVALCYSASPASNASPTHR
14   VALPROSERVALSERSERILEASNARGILE
15   ILEARGTHRLYSVALGLNGLNPROPROASN
16   GLN

Entity 2, DNA_1 25 residues - Formula weight is not available

1   DCDGDGDTDGDGDTDCDADC
2   DGDCDCDTDCDADGDTDGDC
3   DCDCDCDADT

Entity 3, DNA_2 25 residues - Formula weight is not available

1   DGDCDCDADCDCDADGDTDG
2   DCDGDGDADGDTDCDADCDG
3   DGDGDGDTDA

Samples:

sample_1: Paired domain of Pax5, [U-100% 13C; U-100% 15N; U-80% 2H], 0.35 mM; DNA_1 0.35 mM; DNA_2 0.35 mM; MES 20 mM; NaCl 20 mM; DTT 2 mM; EDTA 0.5 mM

sample_conditions_1: ionic strength: 0.02 M; pH: 6.5; pressure: 1 atm; temperature: 298.15 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HN(CO)CAsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment, data analysis

NMR spectrometers:

  • Bruker Avance 850 MHz

Related Database Links: