Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27410

Title: Ile and Met methyl 1H and 13C chemical shifts of DNA polymerase beta, 1-nucleotide gapped double hairpin DNA and dAMPCPP ternary complex   PubMed: 29917149

Authors: DeRose, Eugene; Kirby, Thomas; Mueller, Geoffrey; Beard, William; Wilson, Samuel; London, Robert

Citation: DeRose, Eugene; Kirby, Thomas; Mueller, Geoffrey; Beard, William; Wilson, Samuel; London, Robert. "Transitions in DNA polymerase beta microsecond-millisecond dynamics related to substrate binding and catalysis"  Nucleic Acids Res. 46, 7309-7322 (2018).

Assembly members:
DNA_polymerase_beta_polypeptide, polymer, 335 residues, Formula weight is not available
1-nucleotide_gapped_double_hairpin_DNA, polymer, 23 residues, Formula weight is not available
dAMPCPP, polymer, . residues, Formula weight is not available
entity_MG, non-polymer, 24.305 Da.

Natural source:   Common Name: Rat   Taxonomy ID: 10116   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Rattus norvegicus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
1-nucleotide_gapped_double_hairpin_DNA: GGCGAAGCCTGGTGCGAAGC ACC

Data sets:
Data typeCount
13C chemical shifts29
1H chemical shifts87

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all


Entity Assembly IDEntity NameEntity ID
1DNA polymerase beta1
2hairpin DNA2
4metal ion4


Entity 1, DNA polymerase beta 335 residues - Formula weight is not available


Entity 2, hairpin DNA 23 residues - Formula weight is not available


Entity 3, dAMPCPP - Formula weight is not available

1   X

Entity 4, metal ion - Mg - 24.305 Da.

1   MG


sample_1: DNA polymerase beta polypeptide, Ile CD1-[13CH3],Leu,Val-[13CH3,12CD3],[U-13C; U-15N; U-2H], 400 uM; potassium phosphate 100 mM; DTT 1 mM; sodium azide 10 mM; DSS 80 uM; 1-nucleotide gapped double hairpin DNA 453 uM; MgCl2 10 mM; dAMPCPP 600 uM

sample_2: DNA polymerase beta polypeptide, Ile CD1-[13CH3],Leu,Val-[13CH3,12CD3],Met-[13CH3],[U-15N; U-2H], 200 uM; potassium chloride 150 mM; TRIS, [U-100% 2H], 40 mM; CDTA 1 mM; DTT 1 mM; AEBSF protease inhibitor 0.1 mM; sodium azide 0.04%; DSS 50 uM; 1-nucleotide gapped double hairpin DNA 220 uM; MgCl2 5 mM; dAMPCPP 280 mM

sample_conditions_1: ionic strength: 100 mM; pH: 6.7; pressure: 1 atm; temperature: 308 K

sample_conditions_2: ionic strength: 150 mM; pH: 7.6; pressure: 1 atm; temperature: 308 K


NameSampleSample stateSample conditions
2D 1H-13C HMQC methylsample_1isotropicsample_conditions_1
2D 1H-13C HMQC methylsample_1isotropicsample_conditions_1
2D 1H-13C-HMQC methylsample_2isotropicsample_conditions_2
2D 1H-13C-HMQC methylsample_2isotropicsample_conditions_2
3D HMCM[CG]CBCAsample_1isotropicsample_conditions_1
3D HMCM(CGCBCA)COsample_1isotropicsample_conditions_1
4D methyl 1H-13C-13C-1H NOESY/3D F2F3F4 cubesample_2isotropicsample_conditions_2


VNMRJ v4.2/2.2, Agilent/Varian - collection

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRViewJ, Johnson, One Moon Scientific - chemical shift assignment

NMR spectrometers:

  • Agilent DD2 800 MHz
  • Agilent DD2 600 MHz
  • Varian INOVA 800 MHz
  • Varian INOVA 600 MHz

Related Database Links: