BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30224

Title: Structure Effects of the Four-Adenine Loop of the Coliphage GA Replicase RNA Operator   PubMed: 28488852

Authors: Chang, A.; Tran, M.; DeJong, E.; Nikonowicz, E.

Citation: Chang, A.; Tran, M.; Nikonowicz, E.. "Structure and Dynamics of the Tetra-A Loop and (A-A)-U Sequence Motif within the Coliphage GA Replicase RNA Operator"  Biochemistry 56, 2690-2700 (2017).

Assembly members:
phage GA operator RNA hairpin, polymer, 23 residues, 7394.496 Da.

Natural source:   Common Name: Enterobacteria phage GA   Taxonomy ID: 12018   Superkingdom: Viruses   Kingdom: not available   Genus/species: Levivirus Escherichia virus BZ13

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
phage GA operator RNA hairpin: GGACAUAAGGAAAACCUAUG UCC

Data sets:
Data typeCount
13C chemical shifts158
15N chemical shifts49
1H chemical shifts196
31P chemical shifts21

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 23 residues - 7394.496 Da.

1   GGACAUAAGG
2   AAAACCUAUG
3   UCC

Samples:

sample_4: Pf1 phage 15 mg/mL; phage GA operator RNA hairpin, [U-13C; U-15N], 0.3 ± 0.01 mM; potassium chloride 10 mM; potassium phosphate 10 mM; D2O 100%

sample_5: EDTA 0.02 mM; phage GA operator RNA hairpin, 2H, 40%-85%, 1.2 mM; potassium chloride 10 mM; potassium phosphate 10 mM; D2O 100%

sample_6: EDTA 0.02 mM; phage GA operator RNA hairpin, 13C, 4%-20%, 1.1 mM; potassium chloride 10 mM; potassium phosphate 10 mM; D2O 100%

sample_1: EDTA 0.02 mM; phage GA operator RNA hairpin, [U-13C; U-15N], 1 ± 0.1 mM; potassium chloride 10 mM; potassium phosphate 10 mM; D2O 100%

sample_2: EDTA 0.02 mM; phage GA operator RNA hairpin 1.5 ± 0.1 mM; potassium chloride 10 mM; potassium phosphate 10 mM; D2O 100%

sample_3: EDTA 0.02 mM; phage GA operator RNA hairpin, [U-13C; U-15N], 1 ± 0.1 mM; potassium chloride 10 mM; potassium phosphate 10 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 285 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
3D 1H-13C NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
3D HCCH-TOCSYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_2
2D 1H-31P HetCorsample_5isotropicsample_conditions_1
2D 1H-13C CTEPsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_6isotropicsample_conditions_1
2D 1H-13C HSQCsample_4anisotropicsample_conditions_1
3D 1H-15N NOESYsample_3isotropicsample_conditions_2
2D 1H-13C H(N)COsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C H(CN)COsample_1isotropicsample_conditions_1
2D 1H-13C C(C)H-COSYsample_1isotropicsample_conditions_1

Software:

Felix, Accelrys Software Inc. - processing

X-PLOR NIH v2.43, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 500 MHz

Related Database Links: