BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30257

Title: Structure of wild type pre-miR21 apical loop   PubMed: 28437065

Authors: Shortridge, M.; Varani, G.

Citation: Shortridge, M.; Walker, M.; Pavelitz, T.; Chen, Y.; Varani, G.. "A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing."  ACS Chem. Biol. ., .-. (2017).

Assembly members:
entity_1, polymer, 31 residues, 9912.896 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGUGUUGACUGUUGAAUCUC AUGGCAACACC

Data sets:
Data typeCount
13C chemical shifts129
1H chemical shifts180

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 31 residues - 9912.896 Da.

1   GGUGUUGACU
2   GUUGAAUCUC
3   AUGGCAACAC
4   C

Samples:

sample_1: EDTA 0.01 mM; potassium phosphate 10 mM; pre-miR-21 1.1 mM; sodium chloride 10 mM

sample_2: EDTA 0.01 mM; potassium phosphate 10 mM; pre-miR-21 1.1 mM; sodium chloride 10 mM

sample_3: EDTA 0.01 mM; potassium phosphate 10 mM; pre-miR-21, [U-99% 13C; U-99% 15N], 0.5 mM; sodium chloride 10 mM

sample_4: EDTA 0.01 g/L; potassium phosphate 10 mM; pre-miR-21, [U-99% 13C; U-99% 15N], 0.5 mM; sodium chloride 10 mM

sample_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K

sample_conditions_2: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_3isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
3D 1H-15N NOESYsample_4isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2

Software:

Analysis, CCPN - chemical shift assignment

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment

TOPSPIN, Bruker Biospin - processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker DRX 500 MHz
  • Bruker AvanceIII 800 MHz

Related Database Links: