BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34035

Title: A two-quartet G-quadruplex formed by human telomere in KCl solution at pH 5.0

Authors: Galer, P.; Wang, B.; Sket, P.; Plavec, J.

Citation: Wang, B.; Galer, P.; Sket, P.; Plavec, J.. "Ammonium ion as a probe to asses the kinetics of structural changes upon de/protonation of G-quadruplexes"  . ., .-..

Assembly members:
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'), polymer, 22 residues, 6958.484 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'): TAGGGTTAGGGTTAGGGTTA GG

Data sets:
Data typeCount
1H chemical shifts172

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 22 residues - 6958.484 Da.

1   DTDADGDGDGDTDTDADGDG
2   DGDTDTDADGDGDGDTDTDA
3   DGDG

Samples:

sample_1: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'), 8% 13C, 8% 15N, 1 mM; potassium chloride 70 mM

sample_2: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3') 1 mM; potassium chloride 70 mM

sample_3: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3') 1 mM; potassium chloride 70 mM

sample_conditions_1: ionic strength: 70 mM; pH: 5.0; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
1D 1H-15N HSQCsample_1anisotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_1anisotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_2anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_3anisotropicsample_conditions_1
2D NOESYsample_3anisotropicsample_conditions_1
2D DQF-COSYsample_3anisotropicsample_conditions_1
2D ROESYsample_2anisotropicsample_conditions_1
2D NOESYsample_2anisotropicsample_conditions_1

Software:

AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - chemical shift calculation, refinement

SPARKY, Goddard - peak picking

VNMR, Varian - chemical shift assignment, collection, processing

NMR spectrometers:

  • Agilent-Varian Uniform NMR System 600 MHz
  • Agilent-Varian Uniform NMR System 800 MHz

Related Database Links: