BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34038

Title: SINEB2 element of the long non-coding RNA activator of translation AS Uchl1

Authors: Podbevsek, P.; Plavec, J.

Citation: Podbevsek, P.; Fasolo, F.; Bon, C.; Cimatti, L.; Reisser, S.; Carninci, P.; Bussi, G.; Zucchelli, S.; Plavec, J.; Gustincich, S.. "Structural determinants of the SINEB2 element embedded in the long non-coding RNA activator of translation AS Uchl1"  . ., .-..

Assembly members:
entity_1, polymer, 29 residues, 9309.521 Da.

Natural source:   Common Name: House Mouse   Taxonomy ID: 10090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Mus musculus

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: CCUCGUGGUGGUUGUGAACC ACCAUGUGG

Data sets:
Data typeCount
13C chemical shifts63
15N chemical shifts18
1H chemical shifts93

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 29 residues - 9309.521 Da.

1   CCUCGUGGUG
2   GUUGUGAACC
3   ACCAUGUGG

Samples:

sample_1: RNA (29-MER) 0.5 mM

sample_2: RNA (29-MER) 0.5 mM

sample_3: RNA (29-MER), [U-99% 13C; U-99% 15N], 0.5 mM

sample_conditions_1: pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: pH: 7; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_2
2D 1H-13C HSQCsample_3isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D HCNsample_3isotropicsample_conditions_1

Software:

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment

VNMR, Varian - collection

NMR spectrometers:

  • Agilent VNMRS 600 MHz

Related Database Links: