BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34084

Title: G-quadruplex formed within promoters of Plasmodium falciparum B var genes - form I

Authors: Juribasic Kulcsar, M.; Plavec, J.

Citation: Juribasic Kulcsar, M.; Gabelica, V.; Plavec, J.. "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes"  . ., .-..

Assembly members:
entity_1, polymer, 34 residues, 10664.855 Da.

Natural source:   Common Name: malaria parasite P. falciparum   Taxonomy ID: 5833   Superkingdom: Eukaryota   Kingdom: not available   Genus/species: Plasmodium falciparum

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: CAGGGTTAAGGGTATAACTT TAGGGGTTAGGGTT

Data sets:
Data typeCount
1H chemical shifts305

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 34 residues - 10664.855 Da.

1   DCDADGDGDGDTDTDADADG
2   DGDGDTDADTDADADCDTDT
3   DTDADGDGDGDGDTDTDADG
4   DGDGDTDT

Samples:

sample_1: UpsB-Q-1 DNA (34-MER), 8% 13C, 8% 15N, 1 mM; potassium chloride 150 mM

sample_2: UpsB-Q-1 DNA (34-MER) 1.6 mM; potassium chloride 150 mM

sample_3: UpsB-Q-1 DNA (34-MER) 1.8 mM; potassium chloride 150 mM

sample_conditions_1: ionic strength: 150 mM; pH: 7.0; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_2anisotropicsample_conditions_1
2D 1H-1H NOESYsample_3anisotropicsample_conditions_1
2D 1H-13C HMBCsample_2anisotropicsample_conditions_1
2D 1H-15N HSQCsample_1anisotropicsample_conditions_1
1D 1H-15N HSQCsample_1anisotropicsample_conditions_1

Software:

VNMR, Varian - chemical shift assignment, collection, processing

SPARKY, Goddard - peak picking

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Agilent-Varian Uniform NMR System 800 MHz
  • Agilent-Varian Uniform NMR System 600 MHz

Related Database Links: