BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4120

Title: NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA   PubMed: 9545221

Authors: Kolk, M.; Van der Graaf, M.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.

Citation: Kolk, M.; Van der Graaf, M.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "NMR Structure of a Classical Pseudoknot: Interplay of Single- and Double-Stranded RNA"  Science 280, 434-438 (1998).

Assembly members:
TYMV pseudoknot, polymer, 44 residues, Formula weight is not available

Natural source:   Common Name: TYMV   Taxonomy ID: 12154   Superkingdom: not available   Kingdom: not available   Genus/species: Tymovirus Turnip yellow mosaic virus

Experimental source:   Production method: enzymatic synthesis

Entity Sequences (FASTA):
TYMV pseudoknot: GGGAGCUCAACUCUCCCCCC CUUUUCCGAGGGUCAUCGGA ACCA

Data sets:
Data typeCount
13C chemical shifts297
1H chemical shifts339

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TYMV pseudoknot1

Entities:

Entity 1, TYMV pseudoknot 44 residues - Formula weight is not available

1   GGGAGCUCAA
2   CUCUCCCCCC
3   CUUUUCCGAG
4   GGUCAUCGGA
5   ACCA

Samples:

sample_1: TYMV pseudoknot1 – 2.5 mM; TYMV pseudoknot, [13C/15N adenine], 1 – 2.5 mM; TYMV pseudoknot, [13C/15N uridine], 1 – 2.5 mM; MgCl2 10 mM

sample_cond_1: ionic strength: 10 mM; pH: 6.7; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
(13C-edited/X-filtered)NOESYnot availablenot availablenot available
TOCSYnot availablenot availablenot available
(31P spin echo difference)CTHSQCnot availablenot availablenot available
PCHnot availablenot availablenot available
HCCH-TOCSYnot availablenot availablenot available
CT-TOCSY-HSQCnot availablenot availablenot available
HNCCCHnot availablenot availablenot available

Software:

No software information available

NMR spectrometers:

  • BRUKER AM 400 MHz
  • BRUKER AMX 500 MHz
  • BRUKER AMX 600 MHz
  • VARIAN UNITY+ 750 MHz

Related Database Links: