BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4175

Title: SL3 Hairpin from the Packaging Signal of HIV-1

Authors: Pappalardo, L.; Kerwood, D.; Pelczer, I.; Borer, P.

Citation: Pappalardo, L.; Kerwood, D.; Pelczer, I.; Borer, P.. "Three-dimensional Folding of an RNA Hairpin Required for Packaging HIV-1"  J. Mol. Biol. 282, 801-818 (1998).

Assembly members:
SL3 RNA hairpin, polymer, 20 residues, Formula weight is not available

Natural source:   Common Name: Human Immunodeficiency virus, type 1   Taxonomy ID: 11676   Superkingdom: virus   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
SL3 RNA hairpin: GGACUAGCGGAGGCUAGUCC

Data sets:
Data typeCount
31P chemical shifts19

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SL3 RNA hairpin1

Entities:

Entity 1, SL3 RNA hairpin 20 residues - Formula weight is not available

1   GGACUAGCGG
2   AGGCUAGUCC

Samples:

sample_one: SL3 RNA hairpin 30 mM

sample_conditions_one: pH: 7; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
NOESYsample_onenot availablenot available
DQF-COSYsample_onenot availablenot available
H-PCOSYsample_onenot availablenot available

Software:

No software information available

NMR spectrometers:

  • Bruker DRX 500 MHz

Related Database Links: