BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4226

Title: The Lead-Dependent Ribozyme

Authors: Hoogstraten, C.; Legault, P.; Pardi, A.

Citation: Legault, P.; Hoogstraten, C.; Metlitzky, E.; Pardi, A.. "Order, Dynamics, and Metal-Binding in the Lead-Dependent Ribozyme"  J. Mol. Biol. 284, 325-335 (1998).

Assembly members:
lead-dependent ribozyme, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):
lead-dependent ribozyme: GCGACCGAGCCAGCGAAAGU UGGGAGUCGC

Data sets:
Data typeCount
13C chemical shifts206
15N chemical shifts92
1H chemical shifts278

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1lead-dependent ribozyme1

Entities:

Entity 1, lead-dependent ribozyme 30 residues - Formula weight is not available

1   GCGACCGAGC
2   CAGCGAAAGU
3   UGGGAGUCGC

Samples:

sample_1: lead-dependent ribozyme, [U-99% 13C; U-99% 15N], 1.2 mM; sodium phosphate 10 mM; sodium chloride 100 mM; EDTA 0.2 mM

sample_cond_1: ionic strength: 0.1 M; pH*: 5.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
NOESYsample_1not availablesample_cond_1
CPMG-NOESYsample_1not availablesample_cond_1
BD-NOESYsample_1not availablesample_cond_1
CBD-NOESYsample_1not availablesample_cond_1
NOESY-HSQCsample_1not availablesample_cond_1
CBD-NOESY-HSQCsample_1not availablesample_cond_1
HMQC-NOESY-HSQCsample_1not availablesample_cond_1
HCCH-E.COSYsample_1not availablesample_cond_1
directed HCC-TOCSY-CCH-E.COSYsample_1not availablesample_cond_1
spin-echo difference CT-HCCH-COSYsample_1not availablesample_cond_1

Software:

FELIX v2.3.0, 95.0 - Data Processing

NMR spectrometers:

  • Varian UnityPlus 500 MHz
  • Varian UnityInova 600 MHz
  • Bruker DMX 750 MHz

Related Database Links: