BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4400

Title: Structure and Mechanism of Formation of the H-y5 ismomer of an Intramolecular DNA Triple Helix.

Authors: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.

Citation: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.. "Structure and Mechanism of Formation of the H-y5 isomer of an intramolecular DNA triple helix"  Nat. Struct. Biol. 6, 854-859 (1999).

Assembly members:
H-y5 Triple Helix, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemically_synthesized

Entity Sequences (FASTA):
H-y5 Triple Helix: TCTTCCTTTTCCTTCTCCCG AGAAGGTTTT

Data sets:
Data typeCount
1H chemical shifts247

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1h-y51

Entities:

Entity 1, h-y5 30 residues - Formula weight is not available

1   DTDCDTDTDCDCDTDTDTDT
2   DCDCDTDTDCDTDCDCDCDG
3   DADGDADADGDGDTDTDTDT

Samples:

sample_1: H-y5 Triple Helix2.0 – 4.0 mM

sample_cond_1: ionic strength: 100 mM; pH*: 4.5; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
NOESYsample_1not availablesample_cond_1
PE-COSYsample_1not availablesample_cond_1
TOCSYsample_1not availablesample_cond_1
31P-1Hsample_1not availablesample_cond_1
TOCSY-NOESYsample_1not availablesample_cond_1

Software:

XEASY - assignment book keeping and cross peak integration

NMR spectrometers:

  • Bruker AMX 600 MHz
  • Varian Unitry-Plus 750 MHz
  • Varian Unitry-Plus 500 MHz

Related Database Links: