BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 4813

Title: NMR structure of lac repressor HP62-DNA complex

Authors: Spronk, C.; Bonvin, A.; Radha, P.; Melacini, G.; Boelens, R.; Kaptein, R.

Citation: Spronk, C.; Bonvin, A.; Radha, P.; Melacini, G.; Boelens, R.; Kaptein, R.. "The Solution Structure of Lac Repressor Headpiece 62 Complexed to a Symmetrical Lac Operator"  Structure 7, 1483-1492 (1999).

Assembly members:
LAC REPRESSOR, polymer, 62 residues, Formula weight is not available
LAC OPERATOR, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: 562   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
LAC REPRESSOR: MKPVTLYDVAEYAGVSYQTV SRVVNQASHVSAKTREKVEA AMAELNYIPNRVAQQLAGKQ SL
LAC OPERATOR: GAATTGTGAGCGCTCACAAT TC

Data sets:
Data typeCount
1H chemical shifts595
13C chemical shifts169
15N chemical shifts66

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1LAC REPRESSOR HP62 A1
2LAC REPRESSOR HP62 B1
3LAC OPERATOR C2
4LAC OPERATOR D2

Entities:

Entity 1, LAC REPRESSOR HP62 A 62 residues - Formula weight is not available

1   METLYSPROVALTHRLEUTYRASPVALALA
2   GLUTYRALAGLYVALSERTYRGLNTHRVAL
3   SERARGVALVALASNGLNALASERHISVAL
4   SERALALYSTHRARGGLULYSVALGLUALA
5   ALAMETALAGLULEUASNTYRILEPROASN
6   ARGVALALAGLNGLNLEUALAGLYLYSGLN
7   SERLEU

Entity 2, LAC OPERATOR C 22 residues - Formula weight is not available

1   DGDADADTDTDGDTDGDADG
2   DCDGDCDTDCDADCDADADT
3   DTDC

Samples:

typical_sample: LAC REPRESSOR, [U-100% 13C; U-100% 15N], 1.5 mM; LAC OPERATOR 1.5 mM

sample_cond_1: pH: 6.1; temperature: 315 K

Experiments:

NameSampleSample stateSample conditions
NOESYtypical_samplenot availablesample_cond_1
TOCSYtypical_samplenot availablesample_cond_1
1H-15N HSQCtypical_samplenot availablesample_cond_1
1H-13C HSQCtypical_samplenot availablesample_cond_1
TIME-SHARED 13C-15N DOUBLE-HALF FILTERED NOESYtypical_samplenot availablesample_cond_1
HNCAtypical_samplenot availablesample_cond_1
HN(CO)CAtypical_samplenot availablesample_cond_1
CBCA(CO)NNHtypical_samplenot availablesample_cond_1
H(C)CH-DIPSYtypical_samplenot availablesample_cond_1
(H)CCH-DIPSYtypical_samplenot availablesample_cond_1
HC(C)H-DIPSYtypical_samplenot availablesample_cond_1
1H-15N NOESY-HSQCtypical_samplenot availablesample_cond_1
1H-13C NOESY-HSQCtypical_samplenot availablesample_cond_1
1H-15N TOCSY-HSQCtypical_samplenot availablesample_cond_1
1H-15N HMQC-NOESY-HSQCtypical_samplenot availablesample_cond_1

Software:

X-PLOR v3.851 - REFINEMENT, STRUCTURE CALCULATION

NMR spectrometers:

  • Varian Unity Plus 750 MHz
  • Varian Unity Inova 500 MHz
  • Bruker AMXT 600 MHz
  • Bruker AMX 500 MHz

Related Database Links:

BMRB 1066 127 1494 1552 2956 32 5345 5791 661 736 848 849 96
PDB
DBJ BAB20667 BAB33821 BAD00175 BAD20286 BAD20288
EMBL CAA07594 CAA07597 CAA11118 CAA11119 CAA11120
GB AAA24052 AAA56744 AAA56768 AAA57088 AAA57091
REF NP_286086 NP_308425 NP_414879 WP_000248559 WP_000248563
SP P03023