BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7377

Title: Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states   PubMed: 19636838

Authors: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; David, Giedroc

Citation: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; Giedroc, David. "Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states"  Biomol. NMR Assignments 1, 99-101 (2007).

Assembly members:
CzrA_Chain, polymer, 106 residues, 11988.69 Da.
DNA, polymer, 28 residues, Formula weight is not available

Natural source:   Common Name: Staphylococcus aureus   Taxonomy ID: 1280   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Staphylococcus aureus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli

Entity Sequences (FASTA):
CzrA_Chain: MAEQYSEINTDTLERVTEIF KALGDYNRIRIMELLSVSEA SVGHISHQLNLSQSNVSHQL KLLKSVHLVKAKRQGQSMIY SLDDIHVATMLKQAIHHANH PKESGL
DNA: TAACATATGAACATATGTTC ATATGTTA

Data sets:
Data typeCount
13C chemical shifts360
15N chemical shifts114
1H chemical shifts271

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1czra11
2czra21
3DNA12

Entities:

Entity 1, czra1 106 residues - 11988.69 Da.

1   METALAGLUGLNTYRSERGLUILEASNTHR
2   ASPTHRLEUGLUARGVALTHRGLUILEPHE
3   LYSALALEUGLYASPTYRASNARGILEARG
4   ILEMETGLULEULEUSERVALSERGLUALA
5   SERVALGLYHISILESERHISGLNLEUASN
6   LEUSERGLNSERASNVALSERHISGLNLEU
7   LYSLEULEULYSSERVALHISLEUVALLYS
8   ALALYSARGGLNGLYGLNSERMETILETYR
9   SERLEUASPASPILEHISVALALATHRMET
10   LEULYSGLNALAILEHISHISALAASNHIS
11   PROLYSGLUSERGLYLEU

Entity 2, DNA1 28 residues - Formula weight is not available

1   DTDADADCDADTDADTDGDA
2   DADCDADTDADTDGDTDTDC
3   DADTDADTDGDTDTDA

Samples:

DNACzrA_sample_1: CzrA, [U-100% 13C; U-100% 15N; 80% 2H], 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM

DNACzrA_sample_2: CzrA, [U-10% 13C], 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM

DNACzrA_sample_3: CzrA, [U-2H; U-15N]; [13C]-Ile,Leu,Val-methyl, 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM

DNACzrA_sample_4: CzrA, [U-2H; U-15N]; [13C]-Ile,Leu,Val-methyl; [U-2H]-Leu,Val-methyl, 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.0; pressure: 1 atm; temperature: 313 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N TROSYDNACzrA_sample_1isotropicsample_conditions_1
2D 1H-13C HMQCDNACzrA_sample_1isotropicsample_conditions_1
3D TROSY-HN(COCA)CBDNACzrA_sample_1isotropicsample_conditions_1
3D TROSY-HNCACBDNACzrA_sample_1isotropicsample_conditions_1
3D TROSY-HNCADNACzrA_sample_1isotropicsample_conditions_1
3D 1H-15N NOESY-TROSYDNACzrA_sample_1isotropicsample_conditions_1
3D 1H-13C NOESYDNACzrA_sample_1isotropicsample_conditions_1
4D 13C/15 NOESYDNACzrA_sample_1isotropicsample_conditions_1
3D TROSY-HNCODNACzrA_sample_1isotropicsample_conditions_1
3D TROSY-HNCO (1J HN couplings)DNACzrA_sample_1anisotropicsample_conditions_1
3D TROSY-HNCO (1J COCA couplings)DNACzrA_sample_1anisotropicsample_conditions_1
3D TROSY-HNCO (1J NCA couplings)DNACzrA_sample_1anisotropicsample_conditions_1
2D IPAP-HSQCDNACzrA_sample_1anisotropicsample_conditions_1
3D HMCM[CG]CBCADNACzrA_sample_1isotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

MARS, (MARS)-Jung and Zweckstetter - chemical shift assignment

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 800 MHz
  • Varian INOVA 900 MHz

Related Database Links:

BMRB 15177 7376
PDB
DBJ BAA36687 BAB43231 BAB58307 BAB95934 BAF68321
EMBL CAG41214 CAG43856 CAI81718 CAQ50573 CBI50151
GB AAC32484 AAW38447 ABD21735 ABD31419 ABQ49963
REF NP_372669 NP_375252 NP_646886 WP_000003755 WP_000003756