data_11176 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 11176 _Entry.Title ; Solution Structure of RNA aptamer against AML1 Runt domain ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2010-06-23 _Entry.Accession_date 2010-06-23 _Entry.Last_release_date 2015-06-23 _Entry.Original_release_date 2015-06-23 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.81 _Entry.Original_NMR_STAR_version 3.0.9.14 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Yusuke Nomura . . . 11176 2 Kazuya Fujiwara . . . 11176 3 Manabu Chiba . . . 11176 4 Jun-ichi Fukunaga . . . 11176 5 Yoichiro Tanaka . . . 11176 6 Hiroaki Iibuchi . . . 11176 7 Taku Tanaka . . . 11176 8 Yoshikazu Nakamura . . . 11176 9 Gota Kawai . . . 11176 10 Tomoko Kozu . . . 11176 11 Taiichi Sakamoto . . . 11176 stop_ loop_ _Entry_src.ID _Entry_src.Project_name _Entry_src.Organization_full_name _Entry_src.Organization_initials _Entry_src.Entry_ID 1 . 'RNA engineering in CIT' . 11176 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID AML1/RUNX1 . 11176 'Molecular mimicry' . 11176 'NMR structure' . 11176 'RNA aptamer' . 11176 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 11176 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 105 11176 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2015-06-23 . original BMRB . 11176 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 11176 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title ; A novel high affinity RNA motif that mimics DNA in AML1 Runt domain binding ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Yusuke Nomura . . . 11176 1 2 Jun-ichi Fukunaga . . . 11176 1 3 Yoichiro Tanaka . . . 11176 1 4 Kazuya Fujiwara . . . 11176 1 5 Manabu Chiba . . . 11176 1 6 Hiroaki Iibuchi . . . 11176 1 7 Taku Tanaka . . . 11176 1 8 Yoshikazu Nakamura . . . 11176 1 9 Gota Kawai . . . 11176 1 10 Taiichi Sakamoto . . . 11176 1 11 Tomoko Kozu . . . 11176 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID AML1/RUNX1 11176 1 'Molecular mimicry' 11176 1 'NMR structure' 11176 1 'RNA aptamer' 11176 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 11176 _Assembly.ID 1 _Assembly.Name AML22 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 AML22 1 $entity A . yes native no no . . . 11176 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity _Entity.Sf_category entity _Entity.Sf_framecode entity _Entity.Entry_ID 11176 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name AML22 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGACCCACCACGGCGAGGUC CA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7032 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 11176 1 2 . G . 11176 1 3 . A . 11176 1 4 . C . 11176 1 5 . C . 11176 1 6 . C . 11176 1 7 . A . 11176 1 8 . C . 11176 1 9 . C . 11176 1 10 . A . 11176 1 11 . C . 11176 1 12 . G . 11176 1 13 . G . 11176 1 14 . C . 11176 1 15 . G . 11176 1 16 . A . 11176 1 17 . G . 11176 1 18 . G . 11176 1 19 . U . 11176 1 20 . C . 11176 1 21 . C . 11176 1 22 . A . 11176 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 11176 1 . G 2 2 11176 1 . A 3 3 11176 1 . C 4 4 11176 1 . C 5 5 11176 1 . C 6 6 11176 1 . A 7 7 11176 1 . C 8 8 11176 1 . C 9 9 11176 1 . A 10 10 11176 1 . C 11 11 11176 1 . G 12 12 11176 1 . G 13 13 11176 1 . C 14 14 11176 1 . G 15 15 11176 1 . A 16 16 11176 1 . G 17 17 11176 1 . G 18 18 11176 1 . U 19 19 11176 1 . C 20 20 11176 1 . C 21 21 11176 1 . A 22 22 11176 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 11176 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity . . 'no natural source' . . . . . . . . . . . . . . . . . . . . . 'artificial RNA' 11176 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 11176 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . 'AmpliScribe T7 Transcription Kit' 11176 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 11176 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 AML22 'natural abundance' . . 1 $entity . RNA 0.6 . . mM . . . . 11176 1 2 'sodium phosphate' 'natural abundance' . . . . . salt 10 . . mM . . . . 11176 1 3 D2O 'natural abundance' . . . . . solvent 100 . . % . . . . 11176 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 11176 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 AML22 '[U-100% 13C; U-100% 15N]' . . 1 $entity . RNA 0.5 . . mM . . . . 11176 2 2 'sodium phosphate' 'natural abundance' . . . . . salt 10 . . mM . . . . 11176 2 3 D2O 'natural abundance' . . . . . solvent 100 . . % . . . . 11176 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 11176 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 AML22 'natural abundance' . . 1 $entity . RNA 0.6 . . mM . . . . 11176 3 2 'sodium phosphate' 'natural abundance' . . . . . salt 10 . . mM . . . . 11176 3 3 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 11176 3 4 D2O 'natural abundance' . . . . . solvent 10 . . % . . . . 11176 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 11176 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 AML22 '[U-100% 13C; U-100% 15N]' . . 1 $entity . RNA 0.5 . . mM . . . . 11176 4 2 'sodium phosphate' 'natural abundance' . . . . . salt 10 . . mM . . . . 11176 4 3 H2O 'natural abundance' . . . . . solvent 90 . . % . . . . 11176 4 4 D2O 'natural abundance' . . . . . solvent 10 . . % . . . . 11176 4 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 11176 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 6.5 . pH 11176 1 pressure 1 . atm 11176 1 temperature 283 . K 11176 1 stop_ save_ ############################ # Computer software used # ############################ save_CNS _Software.Sf_category software _Software.Sf_framecode CNS _Software.Entry_ID 11176 _Software.ID 1 _Software.Name CNS _Software.Version 1.1 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 11176 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 11176 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 11176 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DRX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 11176 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DRX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 11176 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker DRX . 500 . . . 11176 1 2 spectrometer_2 Bruker DRX . 600 . . . 11176 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 11176 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-15N HSQC' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 2 '2D 1H-13C HSQC' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 3 '2D 1H-1H TOCSY no.1' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 4 '2D 1H-1H TOCSY no.2' no . . . . . . . . . . 3 $sample_3 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 11176 1 5 '2D 1H-1H NOESY no.1' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 6 '2D 1H-1H NOESY no.2' no . . . . . . . . . . 3 $sample_3 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 7 '2D HCCH-TOCSY' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 8 '2D HCCH-COSY' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 9 '2D HNN-COSY' no . . . . . . . . . . 4 $sample_4 isotropic . . 1 $sample_conditions_1 . . . 2 $spectrometer_2 . . . . . . . . . . . . . . . . 11176 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 11176 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external indirect 1 . . . . . . . . . 11176 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 11176 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 5 '2D 1H-1H NOESY no.1' 1 $sample_1 isotropic 11176 1 6 '2D 1H-1H NOESY no.2' 3 $sample_3 isotropic 11176 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.85 0.02 . 1 . . . . 1 G H1' . 11176 1 2 . 1 1 1 1 G H2' H 1 4.795 0.02 . 1 . . . . 1 G H2' . 11176 1 3 . 1 1 1 1 G H3' H 1 4.66 0.02 . 1 . . . . 1 G H3' . 11176 1 4 . 1 1 1 1 G H8 H 1 8.164 0.02 . 1 . . . . 1 G H8 . 11176 1 5 . 1 1 2 2 G H1' H 1 5.71 0.02 . 1 . . . . 2 G H1' . 11176 1 6 . 1 1 2 2 G H2' H 1 4.505 0.02 . 1 . . . . 2 G H2' . 11176 1 7 . 1 1 2 2 G H3' H 1 4.451 0.02 . 1 . . . . 2 G H3' . 11176 1 8 . 1 1 2 2 G H8 H 1 7.382 0.02 . 1 . . . . 2 G H8 . 11176 1 9 . 1 1 3 3 A H1' H 1 5.917 0.02 . 1 . . . . 3 A H1' . 11176 1 10 . 1 1 3 3 A H2 H 1 7.745 0.02 . 1 . . . . 3 A H2 . 11176 1 11 . 1 1 3 3 A H2' H 1 4.497 0.02 . 1 . . . . 3 A H2' . 11176 1 12 . 1 1 3 3 A H3' H 1 4.576 0.02 . 1 . . . . 3 A H3' . 11176 1 13 . 1 1 3 3 A H8 H 1 7.819 0.02 . 1 . . . . 3 A H8 . 11176 1 14 . 1 1 4 4 C H1' H 1 5.311 0.02 . 1 . . . . 4 C H1' . 11176 1 15 . 1 1 4 4 C H2' H 1 4.3 0.02 . 1 . . . . 4 C H2' . 11176 1 16 . 1 1 4 4 C H3' H 1 4.241 0.02 . 1 . . . . 4 C H3' . 11176 1 17 . 1 1 4 4 C H5 H 1 5.161 0.02 . 1 . . . . 4 C H5 . 11176 1 18 . 1 1 4 4 C H6 H 1 7.365 0.02 . 1 . . . . 4 C H6 . 11176 1 19 . 1 1 5 5 C H1' H 1 5.441 0.02 . 1 . . . . 5 C H1' . 11176 1 20 . 1 1 5 5 C H2' H 1 4.461 0.02 . 1 . . . . 5 C H2' . 11176 1 21 . 1 1 5 5 C H3' H 1 4.636 0.02 . 1 . . . . 5 C H3' . 11176 1 22 . 1 1 5 5 C H5 H 1 5.443 0.02 . 1 . . . . 5 C H5 . 11176 1 23 . 1 1 5 5 C H6 H 1 7.545 0.02 . 1 . . . . 5 C H6 . 11176 1 24 . 1 1 6 6 C H1' H 1 5.411 0.02 . 1 . . . . 6 C H1' . 11176 1 25 . 1 1 6 6 C H2' H 1 4.243 0.02 . 1 . . . . 6 C H2' . 11176 1 26 . 1 1 6 6 C H3' H 1 4.587 0.02 . 1 . . . . 6 C H3' . 11176 1 27 . 1 1 6 6 C H5 H 1 5.629 0.02 . 1 . . . . 6 C H5 . 11176 1 28 . 1 1 6 6 C H6 H 1 7.893 0.02 . 1 . . . . 6 C H6 . 11176 1 29 . 1 1 7 7 A H1' H 1 5.684 0.02 . 1 . . . . 7 A H1' . 11176 1 30 . 1 1 7 7 A H2 H 1 7.851 0.02 . 1 . . . . 7 A H2 . 11176 1 31 . 1 1 7 7 A H2' H 1 4.42 0.02 . 1 . . . . 7 A H2' . 11176 1 32 . 1 1 7 7 A H3' H 1 4.536 0.02 . 1 . . . . 7 A H3' . 11176 1 33 . 1 1 7 7 A H8 H 1 8.218 0.02 . 1 . . . . 7 A H8 . 11176 1 34 . 1 1 8 8 C H1' H 1 5.308 0.02 . 1 . . . . 8 C H1' . 11176 1 35 . 1 1 8 8 C H2' H 1 4.181 0.02 . 1 . . . . 8 C H2' . 11176 1 36 . 1 1 8 8 C H3' H 1 4.25 0.02 . 1 . . . . 8 C H3' . 11176 1 37 . 1 1 8 8 C H5 H 1 5.484 0.02 . 1 . . . . 8 C H5 . 11176 1 38 . 1 1 8 8 C H6 H 1 7.374 0.02 . 1 . . . . 8 C H6 . 11176 1 39 . 1 1 9 9 C H1' H 1 5.713 0.02 . 1 . . . . 9 C H1' . 11176 1 40 . 1 1 9 9 C H2' H 1 3.795 0.02 . 1 . . . . 9 C H2' . 11176 1 41 . 1 1 9 9 C H3' H 1 4.356 0.02 . 1 . . . . 9 C H3' . 11176 1 42 . 1 1 9 9 C H5 H 1 5.684 0.02 . 1 . . . . 9 C H5 . 11176 1 43 . 1 1 9 9 C H6 H 1 7.578 0.02 . 1 . . . . 9 C H6 . 11176 1 44 . 1 1 10 10 A H1' H 1 6.054 0.02 . 1 . . . . 10 A H1' . 11176 1 45 . 1 1 10 10 A H2 H 1 8.184 0.02 . 1 . . . . 10 A H2 . 11176 1 46 . 1 1 10 10 A H2' H 1 5.049 0.02 . 1 . . . . 10 A H2' . 11176 1 47 . 1 1 10 10 A H3' H 1 4.063 0.02 . 1 . . . . 10 A H3' . 11176 1 48 . 1 1 10 10 A H4' H 1 4.46 0.02 . 1 . . . . 10 A H4' . 11176 1 49 . 1 1 10 10 A H8 H 1 8.685 0.02 . 1 . . . . 10 A H8 . 11176 1 50 . 1 1 11 11 C H1' H 1 5.849 0.02 . 1 . . . . 11 C H1' . 11176 1 51 . 1 1 11 11 C H2' H 1 4.004 0.02 . 1 . . . . 11 C H2' . 11176 1 52 . 1 1 11 11 C H3' H 1 4.398 0.02 . 1 . . . . 11 C H3' . 11176 1 53 . 1 1 11 11 C H5 H 1 5.951 0.02 . 1 . . . . 11 C H5 . 11176 1 54 . 1 1 11 11 C H6 H 1 7.579 0.02 . 1 . . . . 11 C H6 . 11176 1 55 . 1 1 12 12 G H1' H 1 5.878 0.02 . 1 . . . . 12 G H1' . 11176 1 56 . 1 1 12 12 G H2' H 1 4.658 0.02 . 1 . . . . 12 G H2' . 11176 1 57 . 1 1 12 12 G H3' H 1 5.528 0.02 . 1 . . . . 12 G H3' . 11176 1 58 . 1 1 12 12 G H8 H 1 7.735 0.02 . 1 . . . . 12 G H8 . 11176 1 59 . 1 1 13 13 G H1' H 1 4.265 0.02 . 1 . . . . 13 G H1' . 11176 1 60 . 1 1 13 13 G H2' H 1 4.466 0.02 . 1 . . . . 13 G H2' . 11176 1 61 . 1 1 13 13 G H3' H 1 4.369 0.02 . 1 . . . . 13 G H3' . 11176 1 62 . 1 1 13 13 G H8 H 1 8.215 0.02 . 1 . . . . 13 G H8 . 11176 1 63 . 1 1 14 14 C H1' H 1 5.442 0.02 . 1 . . . . 14 C H1' . 11176 1 64 . 1 1 14 14 C H2' H 1 3.993 0.02 . 1 . . . . 14 C H2' . 11176 1 65 . 1 1 14 14 C H3' H 1 4.639 0.02 . 1 . . . . 14 C H3' . 11176 1 66 . 1 1 14 14 C H5 H 1 5.52 0.02 . 1 . . . . 14 C H5 . 11176 1 67 . 1 1 14 14 C H6 H 1 7.76 0.02 . 1 . . . . 14 C H6 . 11176 1 68 . 1 1 15 15 G H1' H 1 5.846 0.02 . 1 . . . . 15 G H1' . 11176 1 69 . 1 1 15 15 G H2' H 1 4.497 0.02 . 1 . . . . 15 G H2' . 11176 1 70 . 1 1 15 15 G H3' H 1 4.746 0.02 . 1 . . . . 15 G H3' . 11176 1 71 . 1 1 15 15 G H8 H 1 7.836 0.02 . 1 . . . . 15 G H8 . 11176 1 72 . 1 1 16 16 A H1' H 1 6.105 0.02 . 1 . . . . 16 A H1' . 11176 1 73 . 1 1 16 16 A H2 H 1 8.125 0.02 . 1 . . . . 16 A H2 . 11176 1 74 . 1 1 16 16 A H2' H 1 4.761 0.02 . 1 . . . . 16 A H2' . 11176 1 75 . 1 1 16 16 A H3' H 1 4.659 0.02 . 1 . . . . 16 A H3' . 11176 1 76 . 1 1 16 16 A H4' H 1 4.543 0.02 . 1 . . . . 16 A H4' . 11176 1 77 . 1 1 16 16 A H8 H 1 8.297 0.02 . 1 . . . . 16 A H8 . 11176 1 78 . 1 1 17 17 G H1' H 1 5.323 0.02 . 1 . . . . 17 G H1' . 11176 1 79 . 1 1 17 17 G H2' H 1 4.691 0.02 . 1 . . . . 17 G H2' . 11176 1 80 . 1 1 17 17 G H3' H 1 4.082 0.02 . 1 . . . . 17 G H3' . 11176 1 81 . 1 1 17 17 G H8 H 1 7.47 0.02 . 1 . . . . 17 G H8 . 11176 1 82 . 1 1 18 18 G H1' H 1 5.75 0.02 . 1 . . . . 18 G H1' . 11176 1 83 . 1 1 18 18 G H2' H 1 4.433 0.02 . 1 . . . . 18 G H2' . 11176 1 84 . 1 1 18 18 G H3' H 1 4.029 0.02 . 1 . . . . 18 G H3' . 11176 1 85 . 1 1 18 18 G H8 H 1 7.3 0.02 . 1 . . . . 18 G H8 . 11176 1 86 . 1 1 19 19 U H1' H 1 5.55 0.02 . 1 . . . . 19 U H1' . 11176 1 87 . 1 1 19 19 U H2' H 1 4.499 0.02 . 1 . . . . 19 U H2' . 11176 1 88 . 1 1 19 19 U H3' H 1 4.021 0.02 . 1 . . . . 19 U H3' . 11176 1 89 . 1 1 19 19 U H5 H 1 5.018 0.02 . 1 . . . . 19 U H5 . 11176 1 90 . 1 1 19 19 U H6 H 1 7.768 0.02 . 1 . . . . 19 U H6 . 11176 1 91 . 1 1 20 20 C H1' H 1 5.521 0.02 . 1 . . . . 20 C H1' . 11176 1 92 . 1 1 20 20 C H2' H 1 4.374 0.02 . 1 . . . . 20 C H2' . 11176 1 93 . 1 1 20 20 C H3' H 1 4.341 0.02 . 1 . . . . 20 C H3' . 11176 1 94 . 1 1 20 20 C H5 H 1 5.557 0.02 . 1 . . . . 20 C H5 . 11176 1 95 . 1 1 20 20 C H6 H 1 7.838 0.02 . 1 . . . . 20 C H6 . 11176 1 96 . 1 1 21 21 C H1' H 1 5.342 0.02 . 1 . . . . 21 C H1' . 11176 1 97 . 1 1 21 21 C H2' H 1 4.366 0.02 . 1 . . . . 21 C H2' . 11176 1 98 . 1 1 21 21 C H3' H 1 4.365 0.02 . 1 . . . . 21 C H3' . 11176 1 99 . 1 1 21 21 C H5 H 1 5.399 0.02 . 1 . . . . 21 C H5 . 11176 1 100 . 1 1 21 21 C H6 H 1 7.58 0.02 . 1 . . . . 21 C H6 . 11176 1 101 . 1 1 22 22 A H1' H 1 5.863 0.02 . 1 . . . . 22 A H1' . 11176 1 102 . 1 1 22 22 A H2 H 1 7.194 0.02 . 1 . . . . 22 A H2 . 11176 1 103 . 1 1 22 22 A H2' H 1 3.951 0.02 . 1 . . . . 22 A H2' . 11176 1 104 . 1 1 22 22 A H3' H 1 4.199 0.02 . 1 . . . . 22 A H3' . 11176 1 105 . 1 1 22 22 A H8 H 1 7.918 0.02 . 1 . . . . 22 A H8 . 11176 1 stop_ save_