BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA 1H Chemical Shift Entries

listed by the number of 1H chemical shifts in descending order


Number of entries returned: 293

Query grid description

Retrieve entries as a: Compressed file


Query result listed by the number of 1H chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
7105
SRY.B in complex with 16-mer DNA
1377
619
163
0
X
X
 
18462
Kaiso
1176
607
164
0
X
X
 
5345
LACTOSE OPERON REPRESSOR/DNA Complex
1051
458
138
0
X
X
 
4141
vnd/NK-2 homeodomain DNA complex
840
291
100
18
X
X
 
16485
THAP RRM1
834
351
84
0
X
X
 
19957
DNA-MC1
787
78
103
0
X
X
 
5363
hERR2-DNA complex
764
322
98
0
X
X
 
4248
Lymphoid enhancer-binding factor
733
309
88
0
X
X
 
5349
Extended PBX Homeodomain-DNA complex
706
317
89
0
X
X
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
4165
Tn916 integrase DNA complex
603
231
80
0
X
X
 
17729
C-Terminal domain of Ler
599
151
59
0
X
X
 
5361
TELOMERE REPEAT BINDING FACTOR 1/DNA Complex
599
186
67
0
X
X
 
17732
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
599
70
80
0
X
X
 
15083
SIGMA-54 RPON DOMAIN-DNA COMPLEX
597
208
61
0
X
X
 
25888
F1F2-DNA complex
576
272
200
0
X
X
 
7097
brinker CG9653-PA/DNA Complex
536
255
75
0
X
X
 
16936
MBD2 bound to a methylated DNA
530
307
70
0
X
X
 
4813
LAC REPRESSOR HP62/DNA COMPLEX
513
169
66
0
X
X
 
5791
Lactose operon repressor
497
117
69
0
X
X
 
25407
DNA complex of the C-Terminal domain of MvaT
492
163
51
0
X
X
 
19939
MBD4 methyl-cytosine binding domain bound to methylated DNA
474
291
75
0
X
X
 
4734
High mobility group protein of Drosophila complexed to a bulge DNA
417
46
80
0
X
X
 
5243
5'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'
363
0
0
0
 
X
 
25890
DNA free
340
0
0
0
 
X
 
16138
34-MER, SILVER ION
332
0
0
0
 
X
 
18524
DNA_OUH
325
130
0
0
 
X
 
18881
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
288
56
41
0
 
X
X
19592
Molecular Binding of TFF1 Estrogen Response Element
287
0
0
0
 
X
 
4749
DNA THREE-WAY JUNCTION
282
0
0
0
 
X
 
5370
beta alanine linked polyamide bound to purine tract DNA
272
0
0
0
 
X
 
4172
Rev-erb beta response element
268
0
0
28
 
X
 
25110
left-handed G-quadruplex
267
0
0
0
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
15360
DNA 12mer
266
0
0
22
 
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
4103
14mer DNA duplex containing the operator sequence BS2
258
188
22
0
 
X
 
4104
BS2 operator DNA complexed with the Antennapedia Homeodomain
257
176
23
0
X
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
5167
AT-Rich DNA with the GAA-Hairpin Loop
252
0
0
0
 
X
 
5134
dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'
248
0
0
27
 
X
 
4400
H-y5 Triple Helix
247
0
0
0
 
X
 
25651
active G-quadruplex motif from AGRO100
247
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
11608
DNA CONTAINING METALLO-BASE-PAIR
244
0
0
0
 
X
 
4555
SRY-14mer duplex
243
0
0
26
 
X
 
5135
dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'
241
0
0
26
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
4692
TELOMERE FRAGMENT
239
0
0
21
 
X
 
25906
Glucose as a nuclease mimic in DNA
235
0
0
0
 
X
 
5730
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
234
0
0
0
 
X
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
25378
A G-quadruplex structure
232
0
0
0
 
X
 
5164
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
232
0
0
0
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
16226
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
230
0
0
0
 
X
 
5979
DNA
229
0
0
0
 
X
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
15223
AB_G_alpha
228
0
0
0
 
X
 
15224
AB_G_beta
228
0
0
0
 
X
 
15527
Mbp1_14
227
116
0
25
 
X
 
15227
duplex DNA containing an abasic site with opposite T (alpha anomer)
225
0
0
0
 
X
 
15228
duplex DNA containing an abasic site with opposite T (beta anomer)
225
0
0
0
 
X
 
18907
Duplex DNA
225
0
0
0
 
X
 
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
11528
METALLO-BASE-PAIRED DNA
220
0
0
0
 
X
 
16222
5'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'
220
0
0
0
 
X
 
5714
Synthetic DNA duplex with an AG mismatch
219
0
0
0
 
X
 
30012
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')
218
0
0
0
 
X
 
19375
N2-dG IQ at G3 in NarI sequence
213
0
0
0
 
X
 
11437
Propylene-DNA
213
0
0
0
 
X
 
25903
Glucose in a DNA double helix
212
0
0
0
 
X
 
17409
triazole-linked DNA duplex
212
94
0
0
 
X
 
19745
DNA (28-MER)
212
0
0
0
 
X
 
11438
Protein
211
0
0
0
 
X
 
16356
5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'
210
0
0
0
 
X
 
17397
RET_oncogene
209
0
0
0
 
X
 
17379
5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE
209
0
0
0
 
X
 
25686
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
209
0
0
0
 
X
 
4647
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
208
0
0
0
 
X
 
6537
5'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2
208
0
0
0
 
X
 
4542
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'
206
0
0
0
 
X
 
15238
Ab_C_alpha
205
0
0
0
 
X
 
15026
Nar1IQ3 Duplex
204
0
0
0
 
X
 
15239
Ab_C_beta
204
0
0
0
 
X
 
4187
Sigma-K RNA Polymerase Promoter Consensus Sequence
204
0
0
0
 
X
 
15027
Nar1 Duplex
203
0
0
0
 
X
 
4733
bulge DNA 12/14mer
203
0
0
0
 
X
 
5739
5'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'
203
0
0
0
 
X
 
18040
DNA_1
202
0
0
20
 
X
 
18902
major G-quadruplex
202
0
0
0
 
X
 
19659
RHB Modified duplex
201
0
0
0
 
X
 
5716
CK14 DNA 14-MER DUPLEX
200
0
0
0
 
X
 
18625
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
200
0
0
0
 
X
 
6975
Bcl2MidG4Pu23-G15T/G16T
199
0
0
0
 
X
 
5718
XBY2 DNA 14-MER DUPLEX
198
0
0
0
 
X
 
18626
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
198
0
0
0
 
X
 
19661
SHB modified duplex
198
0
0
0
 
X
 
5927
5'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'
197
0
0
0
 
X
 
4536
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'
197
0
0
0
 
X
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
4416
Cis-syn thymine cyclobutane dimer
193
0
0
22
 
X
 
4415
DNA dodecamer duplex
193
0
0
22
 
X
 
30015
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')
190
0
0
0
 
X
 
19035
G-rich VEGF aptamer with LNA modifications
189
0
0
0
 
X
 
17655
Human Telomeric DNA
189
0
0
0
 
X
 
18690
MOMERIC PIL-E G-QUADRUPLEX DNA
188
0
0
0
 
X
 
17788
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
187
0
0
0
X
X
 
30016
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')
187
0
0
0
 
X
 
19381
DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
186
0
0
0
 
X
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
25672
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
184
0
0
0
 
X
 
19017
Bulges in G-quadruplexes
183
0
0
0
 
X
 
18724
G-quadruplex_DNA
183
0
0
0
 
X
 
18985
DNA_1
182
0
0
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
19572
quadruplex d(TGGGTTTGGGTTGGGTTTGGG)
180
0
0
0
 
X
 
18050
DNA_1
179
0
0
9
 
X
 
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
17887
alpha anomeric lesion
177
56
0
18
 
X
 
19571
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex
176
0
0
0
 
X
 
5781
Propynyl_DNA.RNA_hybrid
175
0
0
0
 
X
X
7392
CTC[IQ]GGCGCCATC
173
0
0
0
 
X
 
17789
(5'S)-8,5'-cyclo-2'-deoxyadenosine
171
0
0
0
 
X
 
4412
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
169
0
0
0
 
X
 
15860
5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'
169
0
0
0
 
X
 
4547
DNA/RNA
168
0
0
16
 
X
X
17786
(5'S)-8,5'-cyclo-2'-deoxyguanosine
167
0
0
0
 
X
 
30148
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30151
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
25596
G-quadruplex
166
0
0
0
 
X
 
4488
DNA decamer
165
0
0
0
 
X
 
30191
DNA Dodecamer with 5-methylcytosine
164
0
0
0
 
X
 
17787
(5'S)-8,5'-cyclo-2'-deoxyguanosine
164
0
0
0
 
X
 
19386
parallel-stranded G-quadruplex in DNA poly-G stretches
164
0
0
0
 
X
 
4409
DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')
163
0
0
0
 
X
 
25528
DNA Dodecamer with 8-oxoguanine at 4th Position
162
0
0
0
 
X
 
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
30038
DNA
162
0
0
14
 
X
 
6009
Thrombin-binding DNA aptamer
162
0
0
14
 
X
 
17422
Cidofovir DNA duplex
162
4
0
0
 
X
 
19853
AGA modified
161
0
0
0
 
X
 
17580
Myc G-quadruplex
161
0
0
0
 
X
 
4362
chromomycin-DNA complex
160
96
0
7
 
X
 
17746
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
160
0
0
0
 
X
 
17980
G-quadruplexes
159
0
0
0
 
X
 
5777
PODN:RNA
157
0
0
0
 
X
X
17423
Control DNA duplex
157
0
0
0
 
X
 
25531
N2-dG IQ at G1 in NarI sequence
156
0
0
0
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
17859
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
155
0
0
0
 
X
 
18762
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
154
0
0
0
 
X
 
19696
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
154
0
0
0
 
X
 
18209
DNA_molecule_G3ATG3ACACAG4ACG3
153
0
0
0
 
X
 
4361
chromomycin-DNA complex
152
80
0
7
 
X
 
17790
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
152
0
0
0
 
X
 
5776
sPrODN1:RNA
152
0
0
0
 
X
X
19695
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
151
0
0
0
 
X
 
18640
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18453
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
17562
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
150
0
0
0
 
X
 
18454
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18639
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
18430
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
149
0
0
0
 
X
 
6430
HIV-1 integrase inhibitor, 93del
148
0
0
15
 
X
 
17229
ZNF_DNA
147
0
0
0
X
X
 
5775
5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'
147
0
0
0
 
X
X
34071
DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')
146
0
0
0
 
X
 
4247
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
145
0
0
0
 
X
X
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
4646
DNA
144
0
0
17
 
X
 
18638
11_mer_oligonucleotide-B
142
0
0
0
 
X
 
19912
DNA duplex
142
0
0
0
 
X
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
17791
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
141
0
0
0
 
X
 
19861
AGT FAPY Modified duplex
140
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
15613
5'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'
138
0
0
0
 
X
 
34025
DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')
138
0
0
0
 
X
 
4556
SRY-8mer duplex
137
0
0
14
 
X
 
16834
5'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'
137
0
0
0
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
4753
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC
135
96
0
7
 
X
 
19389
stacked dimeric G-quadruplex
134
0
0
0
 
X
 
18699
DIMERIC PIL-E G-QUADRUPLEX DNA
134
0
0
0
 
X
 
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
19862
AGC FAPY modified duplex Major isomer
133
0
0
0
 
X
 
4170
DNA-duplex-6GP
131
0
0
0
 
X
 
17708
N-myc
130
0
0
0
 
X
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
19863
AG(7-deaza)G FAPY modified duplex
128
0
0
0
 
X
 
4746
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT
127
80
0
7
 
X
 
4176
DNA dodecamer
123
0
0
0
 
X
 
19620
DNA duplex containing N3T-ethylene-N1I
120
0
0
0
 
X
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
5993
DNA duplex
118
0
0
0
 
X
 
4372
apt
117
0
0
0
 
X
 
18452
Synthetic cyclic oligonucleotide
116
0
0
0
X
X
 
5385
8oxoG:G mismatch
116
0
0
0
 
X
 
17709
N-myc
115
0
0
0
 
X
 
25746
DNA G-quadruplex
114
0
0
0
 
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
19728
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
112
0
0
0
 
X
 
18862
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
111
0
0
0
 
X
 
34053
DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')
109
0
0
0
 
X
 
18835
dodecamer duplex
109
0
0
0
 
X
 
5245
5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'
109
0
0
13
 
X
 
4240
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
109
0
0
0
 
X
 
4576
a3T3 hybrid
104
0
0
0
 
X
 
4618
DNA
104
0
0
0
 
X
 
6273
GTTCACAGAAC DNA hairpin
101
0
0
10
 
X
 
6274
GTACACAGTAC DNA hairpin
101
0
0
0
 
X
 
25099
Hs2 dimer
100
0
0
0
 
X
 
5717
XBY6 DNA 14-MER DUPLEX
100
0
0
0
 
X
 
19886
CGACGCGTCG
98
0
0
0
 
X
 
19889
CGACTAGTCG with AIK-18/51-1
96
0
0
0
 
X
 
4392
DNA minor groove binder
94
0
0
0
 
X
 
4258
MCB12T
94
0
0
0
 
X
 
4244
alphaT decamer duplex
94
0
0
9
 
X
 
5636
SS3
92
75
0
0
 
X
 
5634
SS1
92
75
0
0
 
X
 
5644
SS11
92
75
0
0
 
X
 
5642
SS9
92
75
0
0
 
X
 
5639
SS6
91
74
0
0
 
X
 
5635
SS2
91
74
0
0
 
X
 
5643
SS10
91
74
0
0
 
X
 
5649
SS16
91
74
0
0
 
X
 
5647
SS14
91
74
0
0
 
X
 
5641
SS8
91
74
0
0
 
X
 
5681
CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)
91
0
0
8
 
X
 
5645
SS12
91
74
0
0
 
X
 
5637
SS4
91
74
0
0
 
X
 
5638
SS5
90
73
0
0
 
X
 
5648
SS15
90
73
0
0
 
X
 
5646
SS13
90
73
0
0
 
X
 
5640
SS7
90
73
0
0
 
X
 
36022
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
90
0
0
0
 
X
 
18780
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
89
0
0
0
 
X
 
18781
DNA
88
0
0
0
 
X
 
4243
DNA (5'-D(TCCCGTTTCCA)-3')
84
0
0
10
 
X
 
16054
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
83
0
0
0
 
X
 
4550
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
83
0
0
0
 
X
 
36020
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
82
0
0
0
 
X
 
17814
DNA Containing an Aristolactam II-dA Lesion
82
0
0
0
 
X
 
4235
DNA decamer
82
0
0
9
 
X
 
19890
CGACTAGTCG dimer
82
0
0
0
 
X
 
4835
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
82
0
0
0
 
X
 
19888
CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN
82
0
0
0
 
X
 
16212
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
81
0
0
0
 
X
 
4687
cyclic oligonucleotide d
80
0
0
0
 
X
 
16055
5'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'
79
0
0
0
 
X
 
4694
cyclic oligonucleotide d
76
0
0
0
 
X
 
17885
DNA_dodecamer
73
0
0
0
 
X
 
18427
2'F-ANA and ANA self-complementary duplex
72
0
0
0
 
X
 
15898
DNA GAAA tetraloop
72
42
0
7
 
X
 
19925
DNA dodecamer with A:C mismatch
72
0
0
0
 
X
 
19917
DNA dodecamer containing the 5-hydroxycytosine
70
0
0
0
 
X
 
5282
5'-D(*GP*CP*GP*AP*AP*GP*C)-3'
68
35
9
6
 
X
 
5737
5'-D(*TP*TP*AP*GP*GP*GP*T)-3'
63
0
0
0
 
X
 
25107
DNA-quercetin
61
0
0
0
 
X
 
4609
T-tetrad telomere repeats
59
0
0
0
 
X
 
16292
2:1 complex
58
0
0
0
 
X
 
25759
Quercetin complexed with c-myc G-quadruplex DNA
57
0
0
0
 
X
 
16291
2:1 complex
55
0
0
0
 
X
 
16287
2:1 complex
54
0
0
0
 
X
 
25840
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
51
0
0
0
 
X
 
16290
1:1 complex
50
0
0
0
 
X
 
16288
1:2 complex
49
0
0
0
 
X
 
5562
CCGCGG
49
0
0
0
 
X
 
25915
Photoswitchable G-quadruplex
48
34
0
0
 
X
 
18199
DNA_1
48
0
0
0
 
X
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
16223
5'-D(*DCP*DTP*(FAG)P*DA)-3'
46
0
0
0
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
15033
cyclic octamer
43
20
0
4
 
X
 
16281
1:1 complex
42
0
0
0
 
X
 
16280
d(GAGCTC)2
35
0
0
0
 
X
 

  Back to the initial grid   Top of this page