BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB 31P Chemical Shift Entries

listed by the number of 31P chemical shifts in descending order


Number of entries returned: 127

Query grid description

Retrieve entries as a: Compressed file


Query result listed by the number of 31P chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
19222
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
0
0
0
88
 
X
 
26568
The structure of the SOLE element of oskar mRNA
251
213
38
30
 
 
X
15869
single polyribonucleotide
272
270
47
29
 
 
X
4172
Rev-erb beta response element
268
0
0
28
 
X
 
6509
ScYLV RNA pseudoknot
263
217
96
28
 
 
X
19018
E. coli ribosomela decoding site with apramycin
262
256
101
27
 
 
X
5134
dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'
248
0
0
27
 
X
 
5135
dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'
241
0
0
26
 
X
 
4555
SRY-14mer duplex
243
0
0
26
 
X
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
15527
Mbp1_14
227
116
0
25
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
4416
Cis-syn thymine cyclobutane dimer
193
0
0
22
 
X
 
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
5671
5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'
0
0
0
22
 
X
 
30254
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')
161
115
10
22
 
X
 
30253
DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')
155
113
10
22
 
X
 
25604
double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA
180
151
0
22
 
 
X
4816
INFLUENZA A VIRUS PROMOTER RNA
224
39
23
22
 
 
X
4415
DNA dodecamer duplex
193
0
0
22
 
X
 
15360
DNA 12mer
266
0
0
22
 
X
 
25603
murine tumour necrosis factor alpha CDE RNA
185
148
33
21
 
 
X
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
4692
TELOMERE FRAGMENT
239
0
0
21
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
30255
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')
160
115
10
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
18040
DNA_1
202
0
0
20
 
X
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
17406
5'-R(*GP*UP*GP*AP*AP*GP*CP*CP*CP*GP*U)-3'
156
24
8
20
 
 
X
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
18985
DNA_1
182
0
0
20
 
X
 
4175
SL3 RNA hairpin
175
0
0
19
 
 
X
17887
alpha anomeric lesion
177
56
0
18
 
X
 
4141
vnd/NK-2 homeodomain DNA complex
840
291
100
18
X
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
6979
5'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'/5'-R(*GP*CP*CP*GP*AP*AP*GP*CP*CP*(PR5))-3'
168
0
0
18
 
 
X
5553
C4 promoter of influneza A virus
202
29
11
18
 
 
X
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
4646
DNA
144
0
0
17
 
X
 
15571
RNA DUPLEX
182
124
0
17
 
 
X
5256
Anticodon Stem-loop of tRNA(Phe)
126
110
16
17
 
 
X
6062
NRS23
198
153
15
17
 
 
X
7090
18 mer hairpin hexaloop
149
90
21
17
 
 
X
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
6562
D-loop from cloverleaf 1 of bovine enterovirus 1 RNA
155
120
47
16
 
 
X
17520
Unmodified ASL_Tyr
136
116
41
16
 
 
X
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
4547
DNA/RNA
168
0
0
16
 
X
X
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
4135
RNA duplex including the C-U mismatch
130
0
1
16
 
 
X
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
17517
Anticodon Stem-loop of Bacillus subtilis tRNATYR
80
35
0
16
 
 
X
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
15376
modified DNA duplex
170
0
0
15
 
X
 
6430
HIV-1 integrase inhibitor, 93del
148
0
0
15
 
X
 
18239
RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP*AP*UP*CP*UP*UP*C)-3')
105
0
0
15
 
 
X
15781
5'-R(*GP*UP*CP*GP*UP*GP*CP*UP*G)-3'
148
110
0
15
 
 
X
5259
Anticodon Stem-loop of tRNA(Phe)
114
102
13
14
 
 
X
6009
Thrombin-binding DNA aptamer
162
0
0
14
 
X
 
25415
3' splice site influenza A: 19-nt duplex
140
0
0
14
 
 
X
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
30038
DNA
162
0
0
14
 
X
 
4556
SRY-8mer duplex
137
0
0
14
 
X
 
18240
Mutant of the sub-genomic promoter from Brome Mosaic Virus
100
0
0
14
 
 
X
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
5705
UUCG tetraloop
140
132
47
14
 
 
X
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
5528
RNA (25-MER):the complementary RNA promoter of influenza a virus
219
0
0
13
 
 
X
5245
5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'
109
0
0
13
 
X
 
16714
AUCG tetraloop hairpin
104
104
30
13
 
 
X
19290
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
1155
864
182
11
X
 
X
17351
rG4 substituted Drew Dickerson dodecamer
127
0
0
11
 
 
 
4243
DNA (5'-D(TCCCGTTTCCA)-3')
84
0
0
10
 
X
 
25414
3' splice site influenza A: 11-nt hairpin
97
0
0
10
 
 
X
16951
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
107
50
0
10
 
 
X
15572
RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE
87
57
0
10
 
 
X
16952
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
95
29
5
10
 
 
X
16950
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
85
29
4
10
 
 
X
6273
GTTCACAGAAC DNA hairpin
101
0
0
10
 
X
 
25220
RNA duplex
83
28
0
9
 
 
X
4235
DNA decamer
82
0
0
9
 
X
 
25534
26mer Box C/D RNA (5'-R(P*CP*UP*GP*AP*GP*CP*UP*CP*GP*AP*AP*AP*GP*AP*GP*CP*AP*AP*UP*GP*AP*UP*G)-3')
0
173
49
9
 
 
X
4244
alphaT decamer duplex
94
0
0
9
 
X
 
16609
rna-ligand complex
205
180
27
9
 
 
X
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
18050
DNA_1
179
0
0
9
 
X
 
5614
5'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3'
77
0
0
8
 
 
X
5586
5'-R(*GP*GP*CP*(P5P)P*AP*GP*CP*CP*U)-3'
77
0
0
8
 
 
X
25291
RNA duplex
77
48
0
8
 
 
X
5681
CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)
91
0
0
8
 
X
 
5587
5'-R(*GP*GP*CP*AP*(P5P)P*GP*CP*CP*U)-3'
77
0
0
8
 
 
X
5588
5'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)-3'
80
0
0
8
 
 
X
25526
RNA 27-MER, RIBOSTAMYCIN
205
180
27
8
 
 
X
16953
5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'
81
19
0
8
 
 
X
15780
5'-R(*GP*UP*CP*GP*AP*GP*CP*UP*G)-3'
72
52
0
7
 
 
X
25669
self complementary Xylonucleic Acid duplex
74
72
0
7
 
 
X
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
25661
rna-ligand complex
307
265
117
7
 
 
X
4746
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT
127
80
0
7
 
X
 
4361
chromomycin-DNA complex
152
80
0
7
 
X
 
4753
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC
135
96
0
7
 
X
 
15898
DNA GAAA tetraloop
72
42
0
7
 
X
 
4362
chromomycin-DNA complex
160
96
0
7
 
X
 
5282
5'-D(*GP*CP*GP*AP*AP*GP*C)-3'
68
35
9
6
 
X
 
19734
fd bacteriophage
0
39
0
5
X
X
 
17309
coronavirus stem-loop 2
123
35
0
4
 
 
X
15033
cyclic octamer
43
20
0
4
 
X
 
4894
MATERNAL EFFECT PROTEIN (STAUFEN)/RNA COMPLEX
681
345
93
4
X
 
X
26842
TMR-3_48nt-5-TAMRA
415
382
157
3
 
 
X
17941
IV-B_RNA
243
179
47
2
 
 
X
6145
3LII in DMSO
60
0
0
2
X
 
 
6146
nisin/3LII complex
236
73
34
2
X
 
 
4898
complex of the FYVE domain of EEA1 with PtdIns3P
542
383
109
2
X
 
 
5703
U6 snRNA intramolecular stem loop
204
66
0
1
 
 
X
18656
Internal Loop 5'GAGU/3'UGAG
0
0
0
0
 
 
 

  Back to the initial grid   Top of this page