BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA 31P Chemical Shift Entries

listed by the number of 31P chemical shifts in descending order


Number of entries returned: 67

Query grid description

Retrieve entries as a: Compressed file


Query result listed by the number of 31P chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
19222
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
0
0
0
88
 
X
 
4172
Rev-erb beta response element
268
0
0
28
 
X
 
5134
dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'
248
0
0
27
 
X
 
5135
dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'
241
0
0
26
 
X
 
4555
SRY-14mer duplex
243
0
0
26
 
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
15527
Mbp1_14
227
116
0
25
 
X
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
15360
DNA 12mer
266
0
0
22
 
X
 
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
4416
Cis-syn thymine cyclobutane dimer
193
0
0
22
 
X
 
4415
DNA dodecamer duplex
193
0
0
22
 
X
 
5671
5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'
0
0
0
22
 
X
 
4692
TELOMERE FRAGMENT
239
0
0
21
 
X
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
18985
DNA_1
182
0
0
20
 
X
 
18040
DNA_1
202
0
0
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
17887
alpha anomeric lesion
177
56
0
18
 
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
4141
vnd/NK-2 homeodomain DNA complex
840
291
100
18
X
X
 
4646
DNA
144
0
0
17
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
4547
DNA/RNA
168
0
0
16
 
X
X
6430
HIV-1 integrase inhibitor, 93del
148
0
0
15
 
X
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
6009
Thrombin-binding DNA aptamer
162
0
0
14
 
X
 
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
30038
DNA
162
0
0
14
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
4556
SRY-8mer duplex
137
0
0
14
 
X
 
5245
5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'
109
0
0
13
 
X
 
4243
DNA (5'-D(TCCCGTTTCCA)-3')
84
0
0
10
 
X
 
6273
GTTCACAGAAC DNA hairpin
101
0
0
10
 
X
 
4235
DNA decamer
82
0
0
9
 
X
 
4244
alphaT decamer duplex
94
0
0
9
 
X
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
18050
DNA_1
179
0
0
9
 
X
 
5681
CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)
91
0
0
8
 
X
 
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
4746
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT
127
80
0
7
 
X
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
15898
DNA GAAA tetraloop
72
42
0
7
 
X
 
4753
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC
135
96
0
7
 
X
 
4362
chromomycin-DNA complex
160
96
0
7
 
X
 
4361
chromomycin-DNA complex
152
80
0
7
 
X
 
5282
5'-D(*GP*CP*GP*AP*AP*GP*C)-3'
68
35
9
6
 
X
 
19734
fd bacteriophage
0
39
0
5
X
X
 
15033
cyclic octamer
43
20
0
4
 
X
 

  Back to the initial grid   Top of this page