Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Entries

listed by the number of 1H chemical shifts in descending order

Number of entries returned: 410

Query grid description

Retrieve entries as a: Compressed file

Query result listed by the number of 1H chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
SRY.B in complex with 16-mer DNA
Cdc13 DNA-binding domain /telomeric ssDNA complex
vnd/NK-2 homeodomain DNA complex
hERR2-DNA complex
Lymphoid enhancer-binding factor
Extended PBX Homeodomain-DNA complex
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
RFC p140 375-480 BRCT region : DNA complex
ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex
Tn916 integrase DNA complex
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
C-Terminal domain of Ler
F1F2-DNA complex
YdbC:dT19G1 complex
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
brinker CG9653-PA/DNA Complex
MBD2 bound to a methylated DNA
Switch-activating protein 1/DNA Complex
Egr-1 DNA complex
Lactose operon repressor
DNA complex of the C-Terminal domain of MvaT
A35T vnd/NK2 mutant homeodomain
NMR ensemble Ada Protein
MBD4 methyl-cytosine binding domain bound to methylated DNA
homeodomain transcription factor Gbx1
High mobility group protein of Drosophila complexed to a bulge DNA
Bicoid Homeodomain Bound to DNA
XPF DNA complex
DNA free
UpsB-Q-1 DNA (34-MER)
UpsB-Q-1, DNA (34-MER)
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
Molecular Binding of TFF1 Estrogen Response Element
DNA (26-MER)
beta alanine linked polyamide bound to purine tract DNA
Rev-erb beta response element
polyermase beta in complex with substrate DNA
left-handed G-quadruplex
DNA (26-MER)
HPV-16 E2C-DNA complex
DNA 12mer
MED1:DNA complex
14mer DNA duplex containing the operator sequence BS2
BS2 operator DNA complexed with the Antennapedia Homeodomain
DNA (25-MER)
nkx2.5 homeodomain plus NK2 specific domain in DNA bound state
25-mer DNA oligomer
AT-Rich DNA with the GAA-Hairpin Loop
H-y5 Triple Helix
active G-quadruplex motif from AGRO100
SRY-14mer duplex
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
Glucose as a nuclease mimic in DNA
Tc-DNA/DNA duplex
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
human CEB25 minisatellite G-quadruplex
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
A G-quadruplex structure
antiparallel (2+2) G-quadruplex
Tc-DNA/RNA duplex
duplex DNA containing an abasic site with opposite T (beta anomer)
Duplex DNA
duplex DNA containing an abasic site with opposite T (alpha anomer)
G-quadruplex of Human papillomavirus type 52
Synthetic DNA duplex with an AG mismatch
KRAS oncogene promoter region
N2-dG IQ at G3 in NarI sequence
Glucose in a DNA double helix
DNA (28-MER)
triazole-linked DNA duplex
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
Sigma-K RNA Polymerase Promoter Consensus Sequence
Nar1IQ3 Duplex
bulge DNA 12/14mer
Nar1 Duplex
KRAS promoter region
major G-quadruplex
RHB Modified duplex
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
SHB modified duplex
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
G-quadruplex bound to the bisquinolinium compound Phen-DC3
Cis-syn thymine cyclobutane dimer
DNA dodecamer duplex
tc-DNA/tc-DNA duplex
Human Telomeric DNA
G-rich VEGF aptamer with LNA modifications
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
Bulges in G-quadruplexes
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
EcoRV dimer with cognate DNA
alpha anomeric lesion
EcoRV dimer with cognate DNA and Lu3+
modified DNA duplex
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
DNA decamer
Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)
parallel-stranded G-quadruplex in DNA poly-G stretches
DNA Dodecamer with 5-methylcytosine
artificial quadruplex with propeller, diagonal, and lateral loop
Cidofovir DNA duplex
Thrombin-binding DNA aptamer
DNA Dodecamer with 8-oxoguanine at 10th Position
DNA Dodecamer with 8-oxoguanine at 4th Position
Myc G-quadruplex
AGA modified
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
DNA Dodecamer with 8-oxoguanine at 10th Position
chromomycin-DNA complex
Artificial quadruplex with propeller, diagonal and lateral loop
Metal-response element-binding transcription factor-1 complex with MRE DNA
Control DNA duplex
N2-dG IQ at G1 in NarI sequence
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
dsDNA-lomaiviticin A complex
chromomycin-DNA complex
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
HIV-1 integrase inhibitor, 93del
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
DNA duplex
spermine modified DNA duplex
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
AGT FAPY Modified duplex
SRY-8mer duplex
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
Universal Base oligonucleotide with UB at point 5
Paired domain of Pax5 in complex with DNA
stacked dimeric G-quadruplex
Control DNA oligonucleotide for the universal base
AGC FAPY modified duplex Major isomer
DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')
DNA/RNA hybrid
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
AG(7-deaza)G FAPY modified duplex
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
Homeodomain DNA complex
DNA dodecamer
G-triplex truncated-TBA
DNA duplex
Synthetic cyclic oligonucleotide
8oxoG:G mismatch
DNA duplex containing N3T-ethylene-N1I
DNA G-quadruplex
Kaiso-MeKBSsemi complex
Kaiso-MeKBShemi complex
Kaiso-MeKBS complex
KaisoE535Q-MeKBS complex
KaisoE535A-MeKBS complex
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
KaisoE535Q-MeCG2 complex
Kaiso-MeCG2 complex
KaisoE535A-MeCG2 complex
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
dodecamer duplex
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
WT1 zinc finger domain DNA complex
Protein and DNA complex
a3T3 hybrid
Hs2 dimer
WT1 zinc finger domain
CGACTAGTCG with AIK-18/51-1
DNA minor groove binder
alphaT decamer duplex
Anabaena Sensory Rhodopsin Transducer with DNA
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
IntCB-DNA complex
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
DNA Containing an Aristolactam II-dA Lesion
DNA decamer
cyclic oligonucleotide d
cyclic oligonucleotide d
AFX in complex with DNA
Pbx1 homeodomain
DNA dodecamer with A:C mismatch
DNA GAAA tetraloop
2'F-ANA and ANA self-complementary duplex
DNA dodecamer containing the 5-hydroxycytosine
MazE-DNA binding
T-tetrad telomere repeats
2:1 complex
Quercetin complexed with c-myc G-quadruplex DNA
2:1 complex
2:1 complex
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
MyT1 F4F5 - DNA complex
1:1 complex
1:2 complex
Photoswitchable G-quadruplex
cyclic octamer
1:1 complex
DNA polymerase beta
DNA polymerase beta ternary complex
operator/repressor complex
fd bacteriophage
AREA/GATA complex
The dsDNA in intact bacteriophage T7
CSD/ssDNA complex
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
DNA 1/berenil complex
M13 bacteriophage
SARS/dT10 complex
PPBS/NCp7(12-55) exchange

  Back to the initial grid   Top of this page