BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB DNA Entries

listed by the number of 1H chemical shifts in descending order


Number of entries returned: 376

Query grid description

Retrieve entries as a: Compressed file


Query result listed by the number of 1H chemical shifts in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
7105
SRY.B in complex with 16-mer DNA
1377
619
163
0
X
X
 
18462
Kaiso
1176
607
164
0
X
X
 
5232
Cdc13 DNA-binding domain /telomeric ssDNA complex
1060
823
184
0
X
X
 
5345
LACTOSE OPERON REPRESSOR/DNA Complex
1051
458
138
0
X
X
 
4141
vnd/NK-2 homeodomain DNA complex
840
291
100
18
X
X
 
16485
THAP RRM1
834
351
84
0
X
X
 
19957
DNA-MC1
787
78
103
0
X
X
 
5363
hERR2-DNA complex
764
322
98
0
X
X
 
4248
Lymphoid enhancer-binding factor
733
309
88
0
X
X
 
5349
Extended PBX Homeodomain-DNA complex
706
317
89
0
X
X
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
6353
RFC p140 375-480 BRCT region : DNA complex
628
321
113
0
X
X
 
4165
Tn916 integrase DNA complex
603
231
80
0
X
X
 
17732
Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA
599
70
80
0
X
X
 
17729
C-Terminal domain of Ler
599
151
59
0
X
X
 
5361
TELOMERE REPEAT BINDING FACTOR 1/DNA Complex
599
186
67
0
X
X
 
15083
SIGMA-54 RPON DOMAIN-DNA COMPLEX
597
208
61
0
X
X
 
25888
F1F2-DNA complex
576
272
200
0
X
X
 
18496
YdbC:dT19G1 complex
575
330
70
0
X
X
 
19367
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
560
317
103
0
X
X
 
5517
B-MybR2R3
541
289
101
0
X
X
 
7097
brinker CG9653-PA/DNA Complex
536
255
75
0
X
X
 
16936
MBD2 bound to a methylated DNA
530
307
70
0
X
X
 
36001
Switch-activating protein 1/DNA Complex
514
438
98
0
X
X
 
4813
LAC REPRESSOR HP62/DNA COMPLEX
513
169
66
0
X
X
 
26808
Egr-1 DNA complex
512
366
109
0
X
X
 
5791
Lactose operon repressor
497
117
69
0
X
X
 
25407
DNA complex of the C-Terminal domain of MvaT
492
163
51
0
X
X
 
4368
A35T vnd/NK2 mutant homeodomain
487
265
76
0
X
X
 
6605
NMR ensemble Ada Protein
485
438
142
0
X
X
 
19939
MBD4 methyl-cytosine binding domain bound to methylated DNA
474
291
75
0
X
X
 
18015
PITX2
457
225
89
0
X
X
 
25894
PARP-1_F1F2F3-WGR-DNA_complex
444
0
444
0
X
X
 
19511
homeodomain transcription factor Gbx1
425
248
75
0
X
X
 
4734
High mobility group protein of Drosophila complexed to a bulge DNA
417
46
80
0
X
X
 
6906
Bicoid Homeodomain Bound to DNA
402
310
76
0
X
X
 
17452
Pitx2HD
402
237
89
0
X
X
 
19391
MBD3
391
309
68
0
X
X
 
16449
XPF DNA complex
365
199
73
0
X
X
 
5243
5'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'
363
0
0
0
 
X
 
4256
Mbp1(2-124)
363
156
115
0
X
X
 
25890
DNA free
340
0
0
0
 
X
 
25891
PARP-1_F1F2F3-DNA_complex
335
348
335
0
X
X
 
16138
34-MER, SILVER ION
332
0
0
0
 
X
 
7354
LAC_REPRESSOR
328
248
70
0
X
X
 
18524
DNA_OUH
325
130
0
0
 
X
 
18935
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA
300
571
165
0
X
X
 
18881
d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid
288
56
41
0
 
X
X
19592
Molecular Binding of TFF1 Estrogen Response Element
287
0
0
0
 
X
 
26978
MeCP2-DNA
285
266
72
0
X
X
 
4749
DNA THREE-WAY JUNCTION
282
0
0
0
 
X
 
34086
DNA (26-MER)
274
0
0
0
 
X
 
5370
beta alanine linked polyamide bound to purine tract DNA
272
0
0
0
 
X
 
7319
polyermase beta in complex with substrate DNA
268
775
268
0
X
X
 
4172
Rev-erb beta response element
268
0
0
28
 
X
 
25110
left-handed G-quadruplex
267
0
0
0
 
X
 
6877
HPV-16 E2C-DNA complex
267
245
76
0
X
X
 
15360
DNA 12mer
266
0
0
22
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
16812
MED1:DNA complex
263
145
65
0
X
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
4103
14mer DNA duplex containing the operator sequence BS2
258
188
22
0
 
X
 
4104
BS2 operator DNA complexed with the Antennapedia Homeodomain
257
176
23
0
X
X
 
30058
DNA (25-MER)
256
0
0
0
 
X
 
6319
nkx2.5 homeodomain plus NK2 specific domain in DNA bound state
255
169
134
0
X
X
 
17129
25-mer DNA oligomer
254
139
0
25
 
X
 
5167
AT-Rich DNA with the GAA-Hairpin Loop
252
0
0
0
 
X
 
5134
dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'
248
0
0
27
 
X
 
4400
H-y5 Triple Helix
247
0
0
0
 
X
 
25651
active G-quadruplex motif from AGRO100
247
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
11608
DNA CONTAINING METALLO-BASE-PAIR
244
0
0
0
 
X
 
4555
SRY-14mer duplex
243
0
0
26
 
X
 
5135
dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'
241
0
0
26
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
4692
TELOMERE FRAGMENT
239
0
0
21
 
X
 
25906
Glucose as a nuclease mimic in DNA
235
0
0
0
 
X
 
5730
Benzo[a]Pyrene Adducted Adenine in a DNA duplex
234
0
0
0
 
X
 
18279
human CEB25 minisatellite G-quadruplex
233
56
0
25
 
X
 
5164
5'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex
232
0
0
0
 
X
 
25378
A G-quadruplex structure
232
0
0
0
 
X
 
16225
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
231
0
0
20
 
X
 
16226
5'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'
230
0
0
0
 
X
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
5979
DNA
229
0
0
0
 
X
 
15224
AB_G_beta
228
0
0
0
 
X
 
15223
AB_G_alpha
228
0
0
0
 
X
 
15527
Mbp1_14
227
116
0
25
 
X
 
15228
duplex DNA containing an abasic site with opposite T (beta anomer)
225
0
0
0
 
X
 
15227
duplex DNA containing an abasic site with opposite T (alpha anomer)
225
0
0
0
 
X
 
18907
Duplex DNA
225
0
0
0
 
X
 
19159
d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex
224
0
0
22
 
X
 
16222
5'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'
220
0
0
0
 
X
 
11528
METALLO-BASE-PAIRED DNA
220
0
0
0
 
X
 
5714
Synthetic DNA duplex with an AG mismatch
219
0
0
0
 
X
 
27053
KRAS oncogene promoter region
218
0
0
0
 
X
 
30012
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')
218
0
0
0
 
X
 
19375
N2-dG IQ at G3 in NarI sequence
213
0
0
0
 
X
 
11437
Propylene-DNA
213
0
0
0
 
X
 
17409
triazole-linked DNA duplex
212
94
0
0
 
X
 
25903
Glucose in a DNA double helix
212
0
0
0
 
X
 
19745
DNA (28-MER)
212
0
0
0
 
X
 
11438
Protein
211
0
0
0
 
X
 
16356
5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'
210
0
0
0
 
X
 
30045
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')
210
0
0
0
 
X
 
17397
RET_oncogene
209
0
0
0
 
X
 
17379
5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE
209
0
0
0
 
X
 
25686
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
209
0
0
0
 
X
 
4647
HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct
208
0
0
0
 
X
 
6537
5'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2
208
0
0
0
 
X
 
4542
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'
206
0
0
0
 
X
 
15238
Ab_C_alpha
205
0
0
0
 
X
 
15026
Nar1IQ3 Duplex
204
0
0
0
 
X
 
15239
Ab_C_beta
204
0
0
0
 
X
 
4187
Sigma-K RNA Polymerase Promoter Consensus Sequence
204
0
0
0
 
X
 
27173
KRAS promoter region
203
136
12
0
 
X
 
5739
5'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'
203
0
0
0
 
X
 
4733
bulge DNA 12/14mer
203
0
0
0
 
X
 
15027
Nar1 Duplex
203
0
0
0
 
X
 
18040
DNA_1
202
0
0
20
 
X
 
18902
major G-quadruplex
202
0
0
0
 
X
 
19659
RHB Modified duplex
201
0
0
0
 
X
 
5716
CK14 DNA 14-MER DUPLEX
200
0
0
0
 
X
 
18625
Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'
200
0
0
0
 
X
 
6975
Bcl2MidG4Pu23-G15T/G16T
199
0
0
0
 
X
 
19661
SHB modified duplex
198
0
0
0
 
X
 
5718
XBY2 DNA 14-MER DUPLEX
198
0
0
0
 
X
 
18626
Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin
198
0
0
0
 
X
 
4536
5'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'
197
0
0
0
 
X
 
5927
5'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'
197
0
0
0
 
X
 
34062
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
197
46
0
0
 
X
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
30055
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3')
193
0
0
0
 
X
 
4415
DNA dodecamer duplex
193
0
0
22
 
X
 
4416
Cis-syn thymine cyclobutane dimer
193
0
0
22
 
X
 
30015
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')
190
0
0
0
 
X
 
17655
Human Telomeric DNA
189
0
0
0
 
X
 
19035
G-rich VEGF aptamer with LNA modifications
189
0
0
0
 
X
 
18690
MOMERIC PIL-E G-QUADRUPLEX DNA
188
0
0
0
 
X
 
30016
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')
187
0
0
0
 
X
 
17788
gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct
187
0
0
0
X
X
 
19381
DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
186
0
0
0
 
X
 
18981
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
185
0
0
21
 
X
 
25672
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
184
0
0
0
 
X
 
18724
G-quadruplex_DNA
183
0
0
0
 
X
 
19017
Bulges in G-quadruplexes
183
0
0
0
 
X
 
18985
DNA_1
182
0
0
20
 
X
 
18984
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
182
0
0
20
 
X
 
19158
DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')
181
0
0
18
 
X
 
19572
quadruplex d(TGGGTTTGGGTTGGGTTTGGG)
180
0
0
0
 
X
 
18979
DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer
179
0
0
20
 
X
 
18050
DNA_1
179
0
0
9
 
X
 
18973
DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion
179
0
0
20
 
X
 
17887
alpha anomeric lesion
177
56
0
18
 
X
 
19571
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex
176
0
0
0
 
X
 
5781
Propynyl_DNA.RNA_hybrid
175
0
0
0
 
X
X
7392
CTC[IQ]GGCGCCATC
173
0
0
0
 
X
 
7377
CzrA
173
360
114
0
X
X
 
17789
(5'S)-8,5'-cyclo-2'-deoxyadenosine
171
0
0
0
 
X
 
15376
modified DNA duplex
170
0
0
15
 
X
 
4412
DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')
169
0
0
0
 
X
 
15860
5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'
169
0
0
0
 
X
 
4547
DNA/RNA
168
0
0
16
 
X
X
17786
(5'S)-8,5'-cyclo-2'-deoxyguanosine
167
0
0
0
 
X
 
25596
G-quadruplex
166
0
0
0
 
X
 
30148
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30151
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
4488
DNA decamer
165
0
0
0
 
X
 
6445
Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)
165
490
165
0
X
X
 
17787
(5'S)-8,5'-cyclo-2'-deoxyguanosine
164
0
0
0
 
X
 
26620
Barnase-dCGAC
164
55
109
0
X
X
 
34174
artificial quadruplex with propeller, diagonal, and lateral loop
164
27
0
0
 
X
 
19386
parallel-stranded G-quadruplex in DNA poly-G stretches
164
0
0
0
 
X
 
30191
DNA Dodecamer with 5-methylcytosine
164
0
0
0
 
X
 
4409
DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')
163
0
0
0
 
X
 
17422
Cidofovir DNA duplex
162
4
0
0
 
X
 
30038
DNA
162
0
0
14
 
X
 
6009
Thrombin-binding DNA aptamer
162
0
0
14
 
X
 
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
25528
DNA Dodecamer with 8-oxoguanine at 4th Position
162
0
0
0
 
X
 
19853
AGA modified
161
0
0
0
 
X
 
30254
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')
161
115
10
22
 
X
 
30056
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')
161
0
0
0
 
X
 
17580
Myc G-quadruplex
161
0
0
0
 
X
 
30255
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')
160
115
10
20
 
X
 
4362
chromomycin-DNA complex
160
96
0
7
 
X
 
25369
DNA Dodecamer with 8-oxoguanine at 10th Position
160
0
0
0
 
X
 
17746
(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA
160
0
0
0
 
X
 
17980
G-quadruplexes
159
0
0
0
 
X
 
34063
Artificial quadruplex with propeller, diagonal and lateral loop
158
26
0
0
 
X
 
6276
Metal-response element-binding transcription factor-1 complex with MRE DNA
158
453
158
0
X
X
 
5777
PODN:RNA
157
0
0
0
 
X
X
17423
Control DNA duplex
157
0
0
0
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
25531
N2-dG IQ at G1 in NarI sequence
156
0
0
0
 
X
 
17859
DNA duplex Containing an Unnatural, Hydrophobic Base Pair
155
0
0
0
 
X
 
30253
DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')
155
113
10
22
 
X
 
18762
N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene
154
0
0
0
 
X
 
19696
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
154
0
0
0
 
X
 
25882
dsDNA-lomaiviticin A complex
153
0
0
0
 
X
 
18209
DNA_molecule_G3ATG3ACACAG4ACG3
153
0
0
0
 
X
 
4361
chromomycin-DNA complex
152
80
0
7
 
X
 
17790
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
152
0
0
0
 
X
 
5776
sPrODN1:RNA
152
0
0
0
 
X
X
19695
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
151
0
0
0
 
X
 
18454
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18453
11_mer_oligonucleotide-B
150
0
0
0
 
X
 
18640
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
30328
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
30251
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
18639
Duplex DNA Containing a b-Carba-Fapy-dG Lesion
150
0
0
0
 
X
 
17562
N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal
150
0
0
0
 
X
 
18430
Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine
149
0
0
0
 
X
 
6430
HIV-1 integrase inhibitor, 93del
148
0
0
15
 
X
 
30329
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
148
0
0
0
 
X
 
5775
5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'
147
0
0
0
 
X
X
17229
ZNF_DNA
147
0
0
0
X
X
 
34071
DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')
146
0
0
0
 
X
 
4247
8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction
145
0
0
0
 
X
X
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
4646
DNA
144
0
0
17
 
X
 
30198
DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')
144
0
0
0
 
X
 
30250
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
144
0
0
0
 
X
 
18638
11_mer_oligonucleotide-B
142
0
0
0
 
X
 
19912
DNA duplex
142
0
0
0
 
X
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
17791
(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct
141
0
0
0
 
X
 
19861
AGT FAPY Modified duplex
140
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
15613
5'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'
138
0
0
0
 
X
 
34025
DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')
138
0
0
0
 
X
 
4556
SRY-8mer duplex
137
0
0
14
 
X
 
16834
5'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'
137
0
0
0
 
X
 
34051
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
137
0
0
0
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
26731
Paired domain of Pax5 in complex with DNA
135
424
135
0
X
X
 
4753
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC
135
96
0
7
 
X
 
19389
stacked dimeric G-quadruplex
134
0
0
0
 
X
 
18699
DIMERIC PIL-E G-QUADRUPLEX DNA
134
0
0
0
 
X
 
19862
AGC FAPY modified duplex Major isomer
133
0
0
0
 
X
 
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
4170
DNA-duplex-6GP
131
0
0
0
 
X
 
17535
DNA/RNA hybrid
130
36
0
16
 
X
X
17708
N-myc
130
0
0
0
 
X
 
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
19863
AG(7-deaza)G FAPY modified duplex
128
0
0
0
 
X
 
17697
G-quadruplex
127
0
0
0
 
X
 
4746
D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT
127
80
0
7
 
X
 
16577
Homeodomain DNA complex
126
211
70
0
X
X
 
4176
DNA dodecamer
123
0
0
0
 
X
 
15533
wt1-zf14-14mer
121
0
115
0
X
X
 
19620
DNA duplex containing N3T-ethylene-N1I
120
0
0
0
 
X
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
5993
DNA duplex
118
0
0
0
 
X
 
4372
apt
117
0
0
0
 
X
 
5385
8oxoG:G mismatch
116
0
0
0
 
X
 
34162
DNA (5'-D(*TP*(DCP)P*GP*TP*TP*CP*(DCP)P*GP*TP*TP*TP*TP*TP*CP*GP*TP*TP*CP*CP*GP*T)-3')
116
0
0
0
 
X
 
18452
Synthetic cyclic oligonucleotide
116
0
0
0
X
X
 
17709
N-myc
115
0
0
0
 
X
 
25746
DNA G-quadruplex
114
0
0
0
 
X
 
19728
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
112
0
0
0
 
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
18862
Parallel human telomeric quadruplex containing 2'F-ANA substitutions
111
0
0
0
 
X
 
34053
DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')
109
0
0
0
 
X
 
4240
Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')
109
0
0
0
 
X
 
18835
dodecamer duplex
109
0
0
0
 
X
 
5245
5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'
109
0
0
13
 
X
 
4708
WT1 zinc finger domain DNA complex
108
227
108
0
X
X
 
25582
Protein and DNA complex
107
76
14
0
X
X
 
4576
a3T3 hybrid
104
0
0
0
 
X
 
4618
DNA
104
0
0
0
 
X
 
34054
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
103
0
0
0
 
X
 
6273
GTTCACAGAAC DNA hairpin
101
0
0
10
 
X
 
6274
GTACACAGTAC DNA hairpin
101
0
0
0
 
X
 
25099
Hs2 dimer
100
0
0
0
 
X
 
5717
XBY6 DNA 14-MER DUPLEX
100
0
0
0
 
X
 
19886
CGACGCGTCG
98
0
0
0
 
X
 
4710
WT1 zinc finger domain
97
222
97
0
X
X
 
19889
CGACTAGTCG with AIK-18/51-1
96
0
0
0
 
X
 
4244
alphaT decamer duplex
94
0
0
9
 
X
 
4392
DNA minor groove binder
94
0
0
0
 
X
 
4258
MCB12T
94
0
0
0
 
X
 
17592
Anabaena Sensory Rhodopsin Transducer with DNA
93
306
93
0
X
X
 
5636
SS3
92
75
0
0
 
X
 
5642
SS9
92
75
0
0
 
X
 
5644
SS11
92
75
0
0
 
X
 
5634
SS1
92
75
0
0
 
X
 
5641
SS8
91
74
0
0
 
X
 
5643
SS10
91
74
0
0
 
X
 
5645
SS12
91
74
0
0
 
X
 
5637
SS4
91
74
0
0
 
X
 
5635
SS2
91
74
0
0
 
X
 
5639
SS6
91
74
0
0
 
X
 
5647
SS14
91
74
0
0
 
X
 
5681
CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)
91
0
0
8
 
X
 
5649
SS16
91
74
0
0
 
X
 
5640
SS7
90
73
0
0
 
X
 
5638
SS5
90
73
0
0
 
X
 
36022
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
90
0
0
0
 
X
 
5646
SS13
90
73
0
0
 
X
 
5648
SS15
90
73
0
0
 
X
 
18780
DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link
89
0
0
0
 
X
 
5253
5'-D(*CP*CP*AP*TP*GP*CP*GP*TP*GP*G)-3'
88
0
0
0
 
X
 
18781
DNA
88
0
0
0
 
X
 
15213
IntCB-DNA complex
86
220
86
0
X
X
 
4243
DNA (5'-D(TCCCGTTTCCA)-3')
84
0
0
10
 
X
 
4550
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
83
0
0
0
 
X
 
16054
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
83
0
0
0
 
X
 
17814
DNA Containing an Aristolactam II-dA Lesion
82
0
0
0
 
X
 
17130
zif268-12bpDNA
82
175
82
0
X
X
 
4235
DNA decamer
82
0
0
9
 
X
 
36020
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
82
0
0
0
 
X
 
19890
CGACTAGTCG dimer
82
0
0
0
 
X
 
19888
CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN
82
0
0
0
 
X
 
4835
5'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'
82
0
0
0
 
X
 
5252
5'-D(*CP*CP*AP*CP*GP*CP*GP*TP*GP*G)-3'
82
0
0
0
 
X
 
16212
5'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'
81
0
0
0
 
X
 
4687
cyclic oligonucleotide d
80
0
0
0
 
X
 
34056
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*IP*AP*GP*GP*G)-3')
79
0
0
0
 
X
 
16055
5'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'
79
0
0
0
 
X
 
4694
cyclic oligonucleotide d
76
0
0
0
 
X
 
34118
DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')
75
0
0
0
 
X
 
5032
AFX in complex with DNA
75
147
75
0
X
X
 
4359
Pbx1 homeodomain
74
71
74
0
X
X
 
17885
DNA_dodecamer
73
0
0
0
 
X
 
30252
DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')
73
0
0
0
 
X
 
18427
2'F-ANA and ANA self-complementary duplex
72
0
0
0
 
X
 
15898
DNA GAAA tetraloop
72
42
0
7
 
X
 
19925
DNA dodecamer with A:C mismatch
72
0
0
0
 
X
 
19917
DNA dodecamer containing the 5-hydroxycytosine
70
0
0
0
 
X
 
5282
5'-D(*GP*CP*GP*AP*AP*GP*C)-3'
68
35
9
6
 
X
 
25092
MazE-DNA binding
65
0
61
0
X
X
 
5737
5'-D(*TP*TP*AP*GP*GP*GP*T)-3'
63
0
0
0
 
X
 
25107
DNA-quercetin
61
0
0
0
 
X
 
4609
T-tetrad telomere repeats
59
0
0
0
 
X
 
16292
2:1 complex
58
0
0
0
 
X
 
25759
Quercetin complexed with c-myc G-quadruplex DNA
57
0
0
0
 
X
 
16291
2:1 complex
55
0
0
0
 
X
 
16287
2:1 complex
54
0
0
0
 
X
 
25840
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
51
0
0
0
 
X
 
19540
MyT1 F4F5 - DNA complex
51
115
51
0
X
X
 
16290
1:1 complex
50
0
0
0
 
X
 
16288
1:2 complex
49
0
0
0
 
X
 
5562
CCGCGG
49
0
0
0
 
X
 
16289
d(GCTATAGC)2
48
0
0
7
 
X
 
25915
Photoswitchable G-quadruplex
48
34
0
0
 
X
 
18199
DNA_1
48
0
0
0
 
X
 
16282
d(AGAGCTCT)2
48
0
0
7
 
X
 
16223
5'-D(*DCP*DTP*(FAG)P*DA)-3'
46
0
0
0
 
X
 
16286
d(CGAGCTCG)2
46
0
0
7
 
X
 
15033
cyclic octamer
43
20
0
4
 
X
 
16281
1:1 complex
42
0
0
0
 
X
 
16280
d(GAGCTC)2
35
0
0
0
 
X
 
17217
SARS/dT10 complex
0
0
0
0
X
X
 
17216
PPBS/NCp7(12-55) exchange
0
0
0
0
X
X
 
17339
AREA/GATA complex
0
0
0
0
X
X
 
17225
CSD/ssDNA complex
0
0
0
0
X
X
 
19747
M13 bacteriophage
0
238
53
0
X
X
 
19222
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
0
0
0
88
 
X
 
19805
The dsDNA in intact bacteriophage T7
0
39
14
0
 
X
 
19734
fd bacteriophage
0
39
0
5
X
X
 
17222
operator/repressor complex
0
0
0
0
X
X
 
5671
5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'
0
0
0
22
 
X
 
17094
DNA 1/berenil complex
0
0
0
0
 
X
 

  Back to the initial grid   Top of this page