BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Assigned Chemical Shift Entries

listed by accession number in descending order


Number of entries returned: 11632

Query grid description

Retrieve entries as a: Compressed file


Query result listed by accession number in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
Protein
DNA
RNA
36107
arenicin-3 derivative N2
126
60
24
0
X
 
 
36106
arenicin-3 derivative N1
119
58
24
0
X
 
 
36105
arenicin-3 derivative N6
125
51
23
0
X
 
 
36084
TRADD DD
674
384
126
0
X
 
 
36082
relaxed pUb
364
295
69
0
X
 
 
36081
retracted phosphorylated ubiquitin
308
282
65
0
X
 
 
36062
Synaptotagmin-like protein 4
53
0
0
0
X
 
 
36061
AmyP-SBD
798
530
151
0
X
 
 
36060
TAR DNA-binding protein 43
377
275
78
0
X
 
 
36056
Exoglucanase 1 (E.C.3.2.1.91)
191
111
38
0
X
 
 
36055
Exoglucanase 1 (E.C.3.2.1.91)
191
114
37
0
X
 
 
36054
Exoglucanase 1 (E.C.3.2.1.91)
196
115
38
0
X
 
 
36053
Exoglucanase 1 (E.C.3.2.1.91)
196
115
38
0
X
 
 
36052
Exoglucanase 1 (E.C.3.2.1.91)
196
115
38
0
X
 
 
36051
Exoglucanase 1 (E.C.3.2.1.91)
196
147
38
0
X
 
 
36050
Exoglucanase 1 (E.C.3.2.1.91)
189
109
38
0
X
 
 
36049
Envelope small membrane protein
346
274
65
0
X
 
 
36048
Mutator mutT protein (E.C.3.6.1.55)
810
586
134
0
X
 
 
36038
analogue peptide VG13P
68
0
0
0
X
 
 
36037
Putative uncharacterized protein
527
315
133
0
X
 
 
36034
Eukaryotic translation initiation factor 3 subunit C
527
429
103
0
X
 
 
36027
Human Gelsolin protein domain 1
578
377
126
0
X
 
 
36026
Human Gelsolin protein domain 1
608
114
127
0
X
 
 
36025
Tilapia Piscidin 4
157
0
0
0
X
 
 
36024
Bradykinin-trypsin inhibitor secondary loop chimera
101
0
0
0
X
 
 
36023
Bradykinin-trypsin inhibitor secondary loop chimera
79
0
0
0
X
 
 
36022
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
90
0
0
0
 
X
 
36021
Metabotropic GABA-B receptor subtype 1, Metabotropic GABA-B receptor subtype 3, isoform A
586
406
109
0
X
 
 
36020
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
82
0
0
0
 
X
 
36019
Defensin alpha-related sequence 1
158
0
0
0
X
 
 
36018
Splicing factor 3B subunit 4
549
411
94
0
X
 
 
36017
Uncharacterized protein
126
89
0
0
X
 
 
36016
roseltide rT1
132
0
0
0
X
 
 
36014
Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (E.C.5.2.1.8)
698
510
127
0
X
 
 
36013
DP1, General transcription factor IIH subunit 1
723
557
134
0
X
 
 
36012
Ubiquitin, putative
389
223
77
0
X
 
 
36011
PfSUMO
470
355
93
0
X
 
 
36009
Humanin
126
0
22
0
X
 
 
36008
Small ubiquitin-related modifier 1
611
426
103
0
X
 
 
36007
Small ubiquitin-related modifier 1
581
399
105
0
X
 
 
36006
Small ubiquitin-related modifier 1
582
399
105
0
X
 
 
36005
Calmodulin
647
361
139
0
X
 
 
36001
Switch-activating protein 1/DNA Complex
514
438
98
0
X
X
 
36000
Small ubiquitin-related modifier 1
611
426
102
0
X
 
 
34174
artificial quadruplex with propeller, diagonal, and lateral loop
164
27
0
0
 
X
 
34171
RNA (5'-R(P*AP*UP*AP*CP*(PSU)P*(PSU)P*AP*CP*CP*UP*G)-3'), RNA (5'-R(P*GP*GP*AP*GP*UP*AP*AP*GP*UP*CP*U)-3')
166
147
0
0
 
 
X
34167
Envelope Protein
587
474
110
0
X
 
 
34165
ACE-ARG-ALA-(D)CYS-ARG-BNA-HIS-PEN
48
0
0
0
X
 
 
34163
DNA-binding protein
123
119
78
0
X
 
 
34162
DNA (5'-D(*TP*(DCP)P*GP*TP*TP*CP*(DCP)P*GP*TP*TP*TP*TP*TP*CP*GP*TP*TP*CP*CP*GP*T)-3')
116
0
0
0
 
X
 
34154
Receptor tyrosine-protein kinase erbB-2 (E.C.2.7.10.1)
259
202
47
0
X
 
 
34144
Nucleolysin TIA-1 isoform p40
509
383
88
0
X
 
 
34143
Breast cancer anti-estrogen resistance 1,Vinculin
540
395
86
0
X
 
 
34142
Breast cancer anti-estrogen resistance 1,Tyrosine-protein phosphatase non-receptor type 12 (E.C.3.1.3.48)
543
385
86
0
X
 
 
34141
Breast cancer anti-estrogen resistance 1
451
336
80
0
X
 
 
34140
Protein NRD1
1017
453
182
0
X
 
 
34139
sh3b domain
583
439
111
0
X
 
 
34127
MatB protein
622
349
124
0
X
 
 
34126
MatA protein
688
393
120
0
X
 
 
34124
Loquacious, isoform B
373
237
76
0
X
 
 
34123
Loquacious
309
142
59
0
X
 
 
34120
Ribosome hibernation promotion factor
640
516
120
0
X
 
 
34118
DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')
75
0
0
0
 
X
 
34116
Agnoprotein
387
0
0
0
X
 
 
34114
rSP-C33Leu -RECOMBINANT PULMONARY SURFACTANT-ASSOCIATED POLYPEPTIDE C ANALOGUE-
203
41
31
0
X
 
 
34113
Defensin-1
300
200
51
0
X
 
 
34112
Competence protein ComGC
296
236
61
0
X
 
 
34111
RNA chaperone ProQ
261
156
54
0
X
 
 
34110
RNA chaperone ProQ
604
493
126
0
X
 
 
34108
Toll-like receptor 4
281
221
49
0
X
 
 
34105
Dehydroascorbate reductase family protein
188
0
188
0
X
 
 
34094
Protein (chimeric oligourea-peptide zinc finger)
183
60
30
0
X
 
 
34093
Dehydroascorbate reductase family protein
187
0
187
0
X
 
 
34092
TRP-TYR-HIS-ARG-LEU-SER-HIS-ILE-HIS-SER-ARG-LEU-GLN-ASP-NH2
92
55
0
0
X
 
 
34091
TRP-TYR-HIS-ARG-LEU-SER-HIS-LEU-HIS-SER-ARG-LEU-GLN-ASP-NH2
91
55
0
0
X
 
 
34090
GLY-LEU-PHE-ASP-ILE-VAL-LYS-LYS-VAL-VAL-GLY-ALA-LEU-GLY-NH2
82
49
0
0
X
 
 
34089
RNA polymerase sigma factor SigA
438
329
79
0
X
 
 
34086
DNA (26-MER)
274
0
0
0
 
X
 
34082
Anti-sigma-F factor Fin
379
272
79
0
X
 
 
34081
TAR DNA-binding protein 43
478
0
1
0
X
 
 
34080
hnRNP A1 RRM2 in complex with 5'-UCAGUU-3' RNA
560
293
92
0
X
 
X
34075
GLY-ILE-LEU-SER-SER-LEU-TRP-LYS-LYS-LEU-LYS-LYS-ILE-ILE-ALA-LYS
115
0
16
0
X
 
 
34074
GLY-ILE-LEU-SER-SER-LEU-TRP-LYS-LYS-LEU-LYS-LYS-ILE-ILE-ALA-LYS
109
50
16
0
X
 
 
34073
Peroxin 14
424
245
68
0
X
 
 
34072
Putative metallothionein
469
240
99
0
X
 
 
34071
DNA (5'-D(*GP*GP*(FT)P*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3')
146
0
0
0
 
X
 
34070
Insulin
295
0
0
0
X
 
 
34069
Islet amyloid polypeptide
196
56
42
0
X
 
 
34068
RNA-binding protein 5
357
282
65
0
X
 
 
34067
RNA-binding protein 5, Survival motor neuron protein
393
292
65
0
X
 
 
34064
Lipoprotein cytochrome c, 1 heme-binding site
433
0
73
0
X
 
 
34063
Artificial quadruplex with propeller, diagonal and lateral loop
158
26
0
0
 
X
 
34062
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
197
46
0
0
 
X
 
34061
Protein PCF11
301
228
52
0
X
 
 
34059
Arenicin-1
146
79
29
0
X
 
 
34058
Regulator of Ty1 transposition protein 103, THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER
847
487
147
0
X
 
 
34057
CUGBP Elav-like family member 2/RNA Complex
673
335
114
0
X
 
X
34056
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*IP*AP*GP*GP*G)-3')
79
0
0
0
 
X
 
34055
Variant surface glycoprotein MITAT 1.1
447
0
81
0
X
 
 
34054
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
103
0
0
0
 
X
 
34053
DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')
109
0
0
0
 
X
 
34052
Curli production assembly/transport component CsgF
565
428
122
0
X
 
 
34051
DNA (5'-D(*GP*CP*GP*AP*GP*GP*GP*AP*GP*CP*GP*AP*GP*GP*G)-3')
137
0
0
0
 
X
 
34050
Gag protein
905
0
183
0
X
 
 
34048
Fibronectin
480
280
90
0
X
 
 
34047
Decoration protein
441
332
68
0
X
 
 
34046
Decoration protein
462
381
91
0
X
 
 
34045
Phosphoprotein
334
245
53
0
X
 
 
34044
Bacteriocin BacSp222
308
228
55
0
X
 
 
34043
Protein TonB
530
384
92
0
X
 
 
34042
Adhesin protein
771
614
130
0
X
 
 
34041
Regulator of Ty1 transposition protein 103, PRO-SER-TYR-SER-PRO-PTH-SER-PRO-SER-TYR-SER-PRO-THR-SER-PRO-SER
832
472
144
0
X
 
 
34040
Epidermal growth factor receptor (E.C.2.7.10.1)
252
190
42
0
X
 
 
34039
VC-1=CYTOTOXIN
382
277
61
0
X
 
 
34038
RNA (29-MER)
93
63
18
0
 
 
X
34037
Beta-nerve growth factor
1254
1008
246
0
X
 
 
34036
Non-specific lipid-transfer protein 2
504
362
97
0
X
 
 
34033
PPa-CH3
199
38
32
0
X
 
 
34032
PPaOMe
199
39
32
0
X
 
 
34031
PPaTyr
191
41
32
0
X
 
 
34030
Peroxisomal biogenesis factor 19
881
486
145
0
X
 
 
34029
Matrix protein p10
449
420
116
0
X
 
 
34027
L-2
174
10
34
0
X
 
 
34026
Neural cell adhesion molecule 1
580
331
101
0
X
 
 
34025
DNA (5'-D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T)-3')
138
0
0
0
 
X
 
34024
Fusion protein 5.5/5.7
350
272
67
0
X
 
 
34022
Uncharacterized protein
916
693
145
0
X
 
 
34019
Amyloid beta A4 protein
58
35
8
0
X
 
 
34018
Lactococcin-A immunity protein
476
394
98
0
X
 
 
34017
ACE-ARG-ALA-DCY-ARG-PHE-PHE-CYS
48
0
0
0
X
 
 
34016
ARG-ALA-CYS-ARG-PHE-PHE-CYS
43
0
0
0
X
 
 
34015
myristoylated M-PMV matrix protein mutant
577
374
100
0
X
 
 
34014
Gallinacin-7
289
136
43
0
X
 
 
34013
BolA-like protein 1
640
465
126
0
X
 
 
34012
Bacteriochlorophyll c-binding protein
0
163
44
0
X
 
 
34011
Small toxic polypeptide LdrD
177
118
0
0
X
 
 
34010
Inner membrane protein YgaP
516
310
0
0
X
 
 
34009
Inner membrane protein YgaP
558
303
110
0
X
 
 
34008
tau-AnmTx Ueq 12-1
227
99
45
0
X
 
 
34007
Zinc finger HIT domain-containing protein 3, Nuclear fragile X mental retardation-interacting protein 1
675
488
125
0
X
 
 
34006
Enterococcin K1
260
149
35
0
X
 
 
34005
C-X-C motif chemokine 13
490
313
81
0
X
 
 
34004
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1
468
273
77
0
X
 
 
34003
Major prion protein
745
427
143
0
X
 
 
34002
Insulin-like growth factor II
397
279
73
0
X
 
 
34001
Insulin-like growth factor II
396
184
71
0
X
 
 
34000
Insulin-like growth factor II
386
174
72
0
X
 
 
30353
Talin-1, Ras-related protein Rap-1b
1173
869
234
0
X
 
 
30348
NleG5-1
581
438
97
0
X
 
 
30334
Thioredoxin
544
443
111
0
X
 
 
30332
Tyrosine-protein kinase ABL1 (E.C.2.7.10.2)
1065
834
180
0
X
 
 
30331
Tyrosine-protein kinase ABL1 (E.C.2.7.10.2)
602
869
224
0
X
 
 
30329
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
148
0
0
0
 
X
 
30328
DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
30320
38-mer peptide
166
58
0
0
X
 
 
30319
SER-PRO-GLU-GLU-ARG-ALA-GLN-LEU-CYS-THR-ALA-ALA-GLU-LYS-ALA-ASP-GLU-LEU-GLY
210
87
0
0
X
 
 
30317
Beta-theraphotoxin-Ps1a
222
93
34
0
X
 
 
30316
Interleukin-8
337
251
61
0
X
 
 
30315
ShK homolog AsK132958
161
0
33
0
X
 
 
30314
Insulin
245
205
48
0
X
 
 
30308
Troponin C, slow skeletal and cardiac muscles, Troponin I, cardiac muscle
668
505
111
0
X
 
 
30306
Stress Response Peptide-2
130
0
0
0
X
 
 
30304
RNA-binding protein FUS
0
173
45
0
X
 
 
30297
Cytoplasmic Tail of HIV-1 gp41 protein
560
462
107
0
X
 
 
30293
Yeast dnaJ protein 1
457
340
70
0
X
 
 
30291
Turripeptide
70
25
16
0
X
 
 
30290
Thioredoxin
523
448
105
0
X
 
 
30289
Villin-4
280
253
66
0
X
 
 
30288
Troponin C, slow skeletal and cardiac muscles,Troponin I, cardiac muscle
658
503
114
0
X
 
 
30285
human Tsg101 UEV in complex with tenatoprazole
894
521
143
0
X
 
 
30284
Adhesion invasion locus
91
94
91
0
X
 
 
30283
RNA (5'-R(*GP*AP*CP*CP*UP*GP*CP*UP*GP*CP*UP*GP*GP*UP*C)-3')
53
0
0
0
 
 
X
30282
RNA (5'-R(*GP*AP*CP*CP*AP*GP*CP*AP*G)-3')
69
0
0
0
 
 
X
30281
Annexin A1
125
13
18
0
X
 
 
30276
Polyubiquitin-B, E3 ubiquitin-protein ligase RAD18 (E.C.2.3.2.27)
695
391
109
0
X
 
 
30275
Histone H2A, Polyubiquitin-B, E3 ubiquitin-protein ligase RNF169 (E.C.2.3.2.27)
1752
1268
319
0
X
 
 
30274
cyc-MC12
83
29
14
0
X
 
 
30272
M protein
205
163
38
0
X
 
 
30271
M protein
144
133
37
0
X
 
 
30268
RNA (5'-R(*CP*CP*AP*GP*AP*AP*AP*CP*GP*GP*AP*UP*GP*GP*A)-3')
88
0
0
13
 
 
X
30267
20-mer Peptide
96
58
0
0
X
 
 
30262
RNA (41-MER)
110
0
0
0
 
 
X
30261
RNA (41-MER)
131
0
0
0
 
 
X
30258
14-mer Peptide/RNA Complex
234
0
13
0
X
 
X
30257
pre-miR-21
180
129
0
0
 
 
X
30255
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')
160
115
10
20
 
X
 
30254
DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')
161
115
10
22
 
X
 
30253
DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')
155
113
10
22
 
X
 
30252
DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')
73
0
0
0
 
X
 
30251
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')
150
0
0
0
 
X
 
30250
DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')
144
0
0
0
 
X
 
30249
HEEH_rd4_0097
239
173
46
0
X
 
 
30247
Papain-like proteinase (E.C.3.4.19.12,3.4.22.69)
431
332
83
0
X
 
 
30245
UPF0297 protein EF_1202
996
750
176
0
X
 
 
30244
Heterogeneous-backbone Foldamer Mimic of the Sp1-3 Zinc Finger
203
0
0
0
X
 
 
30243
RNA polymerase II transcription factor B subunit 1, Transcription factor p65
857
641
152
0
X
 
 
30242
EHEE_rd1_0284
174
127
24
0
X
 
 
30241
EEHEE_rd3_1049
268
202
42
0
X
 
 
30240
HHH_rd1_0142
242
168
40
0
X
 
 
30239
Uncharacterized protein
328
164
62
0
X
 
 
30236
Bacteriocin
202
104
37
0
X
 
 
30235
Bacteriocin
157
90
30
0
X
 
 
30234
Ubiquitin
140
0
140
0
X
 
 
30231
Adrenodoxin
481
443
107
0
X
 
 
30230
Klebsidin
89
0
0
0
X
 
 
30229
Acinetodin
100
0
0
0
X
 
 
30227
ILE-HIS-VAL-HIS-LEU-GLN-ILE
0
69
18
0
X
 
 
30226
Alpha-conotoxin GID
100
34
0
0
X
 
 
30225
Alpha-conotoxin GID
98
36
0
0
X
 
 
30224
phage GA operator RNA hairpin
196
158
49
21
 
 
X
30223
Immunoglobulin G-binding protein G
271
230
61
0
X
 
 
30222
Immunoglobulin G-binding protein G
271
230
61
0
X
 
 
30221
Immunoglobulin G-binding protein G
280
240
61
0
X
 
 
30220
Immunoglobulin G-binding protein G
282
221
61
0
X
 
 
30219
Ocellatin-F1
123
77
24
0
X
 
 
30218
Ocellatin-LB2
111
56
6
0
X
 
 
30217
Ocellatin-LB1
106
59
18
0
X
 
 
30216
Ocellatin-K1
126
77
24
0
X
 
 
30215
Ocellatin-K1
111
68
17
0
X
 
 
30214
Ocellatin-LB1
107
68
21
0
X
 
 
30213
Ocellatin-F1
132
78
24
0
X
 
 
30212
Ocellatin-LB2
116
71
22
0
X
 
 
30210
Muscleblind-like protein 1/RNA Complex
472
300
85
0
X
 
X
30209
Preproalbumin PawS1
671
482
109
0
X
 
 
30208
Muscleblind-like protein 1
397
220
72
0
X
 
 
30207
Muscleblind-like protein 1
437
262
81
0
X
 
 
30206
Bromodomain-containing protein 2, Stat3 peptide
708
448
100
0
X
 
 
30205
HMWP2 nonribosomal peptide synthetase
615
466
105
0
X
 
 
30204
HH2
144
117
29
0
X
 
 
30203
Cyclic peptide ALA-ALA-ALA-UN1-ALA-ARG-ALA-ALA-ARG-ALA-ALA-ARG-ALA
26
0
0
0
X
 
 
30202
Cyclic tetrapeptide ALA-ARG-ALA-UN1
8
0
0
0
X
 
 
30201
Nucleoporin POM152
624
471
106
0
X
 
 
30200
Degenerin mec-4
91
287
91
0
X
 
 
30199
Siderophore yersiniabactin
416
349
79
0
X
 
 
30198
DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')
144
0
0
0
 
X
 
30197
E3 ubiquitin-protein ligase parkin (E.C.6.3.2.-)
410
335
80
0
X
 
 
30196
Calmodulin, Nitric oxide synthase, inducible (E.C.1.14.13.39)
839
438
161
0
X
 
 
30195
Calmodulin
604
266
142
0
X
 
 
30194
HTH-type transcriptional regulator SinR
288
210
54
0
X
 
 
30193
HTH-type transcriptional regulator SinR
384
309
66
0
X
 
 
30192
Protein SinI
340
252
51
0
X
 
 
30191
DNA Dodecamer with 5-methylcytosine
164
0
0
0
 
X
 
30190
Mu-theraphotoxin-Hs2a
203
89
31
0
X
 
 
30189
Thiol:disulfide interchange protein DsbA
106
106
0
0
X
 
 
30188
Benenodin-1
119
0
0
0
X
 
 
30187
Benenodin-1
110
0
0
0
X
 
 
30186
PS1
712
377
129
0
X
 
 
30185
PS1
674
361
108
0
X
 
 
30184
RNA
96
0
0
0
 
 
 
30181
Beta/omega-theraphotoxin-Tp2a analog
150
0
32
0
X
 
 
30180
Dihydroorotate dehydrogenase (quinone), mitochondrial (E.C.1.3.5.2)
198
51
32
0
X
 
 
30179
Conantokin-R1-B
91
61
19
0
X
 
 
30178
Conantokin
92
74
19
0
X
 
 
30177
PHD finger protein 20, Histone H3.1
396
289
62
0
X
 
 
30176
Conantokin
100
60
18
0
X
 
 
30172
Cytotoxin 1
383
285
61
0
X
 
 
30171
Reverse transcriptase
467
276
86
0
X
 
 
30170
Toll/interleukin-1 receptor domain-containing adapter protein
19
61
19
0
X
 
 
30168
Chi-conotoxin-like PnMRCL-013
64
0
0
0
X
 
 
30167
Chi-conotoxin-like PnMRCL-013
66
0
0
0
X
 
 
30165
Microcin J25
206
0
0
0
X
 
 
30164
Mu-theraphotoxin-Pn3a
190
79
33
0
X
 
 
30163
Lipocalin-1
132
0
132
0
X
 
 
30162
Envelope glycoprotein
232
187
49
0
X
 
 
30161
Two-component system response regulator
552
468
111
0
X
 
 
30160
Mu-theraphotoxin-Hs2a
221
153
41
0
X
 
 
30159
Phosphocarrier protein NPr (E.C.2.7.11.-), Phosphoenolpyruvate-protein phosphotransferase PtsP (E.C.2.7.3.9)
285
821
285
0
X
 
 
30158
Phosphocarrier protein NPr (E.C.2.7.11.-)
74
152
74
0
X
 
 
30157
Phosphocarrier protein NPr (E.C.2.7.11.-)
345
312
88
0
X
 
 
30156
Calmodulin, Estrogen receptor peptide
506
437
145
0
X
 
 
30155
ELAV-like protein 1
554
412
106
0
X
 
 
30154
Uncharacterized protein aq_1974
509
385
77
0
X
 
 
30153
Bifunctional coenzyme PQQ synthesis protein C/D (E.C.1.3.3.11)
525
405
87
0
X
 
 
30152
[D-Trp3]-Contryphan-Vc2
42
26
7
0
X
 
 
30151
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30150
Bcl-2-like protein 1
1081
647
209
0
X
 
 
30149
Chlorotoxin
206
136
37
0
X
 
 
30148
DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')
166
0
0
0
 
X
 
30147
Neurogenic locus notch homolog protein 1
45
137
46
0
X
 
 
30146
Designed peptide NC_cEE_D1
112
62
14
0
X
 
 
30145
Designed peptide NC_cHHH_D1
136
60
22
0
X
 
 
30144
Designed peptide NC_cHh_DL_D1
167
46
21
0
X
 
 
30143
Designed peptide NC_cHH_D1
189
57
24
0
X
 
 
30142
Designed peptide NC_EEH_D1
156
73
21
0
X
 
 
30141
Designed peptide NC_EEH_D2
153
80
22
0
X
 
 
30140
Designed peptide NC_EHE_D1
171
85
22
0
X
 
 
30139
Zoocin A endopeptidase
728
575
160
0
X
 
 
30138
Designed peptide NC_HEE_D1
182
73
23
0
X
 
 
30137
Scavenger receptor class B member 1
414
284
68
0
X
 
 
30136
Flagellar protein FliT
190
194
103
0
X
 
 
30135
Eukaryotic elongation factor 2 kinase (E.C.2.7.11.20)
532
416
109
0
X
 
 
30134
Flagellar protein FliT,Flagellar hook-associated protein 2
570
528
139
0
X
 
 
30133
2''-aminoglycoside nucleotidyltransferase (E.C.2.7.7.46)
868
778
167
0
X
 
 
30132
Telomerase RNA P2ab
272
206
37
0
 
 
X
30131
Peptidase M23 (E.C.3.4.24.75)
841
465
135
0
X
 
 
30130
Peptidase M23 (E.C.3.4.24.75)
851
474
138
0
X
 
 
30129
De novo Beta Sheet Design Protein OR485
489
337
80
0
X
 
 
30128
De novo Beta Sheet Design Protein OR664
650
384
121
0
X
 
 
30127
Flagellar protein FliT,Flagellum-specific ATP synthase (E.C.3.6.3.14)
294
500
139
0
X
 
 
30126
La-related protein 7
729
520
121
0
X
 
 
30124
O2_contryphan_Vc1 prepropeptide
122
73
24
0
X
 
 
30123
Gap junction beta-1 protein
113
42
0
0
X
 
 
30121
Beta-amyloid protein 42
0
123
29
0
X
 
 
30120
Gap junction beta-2 protein
118
41
0
0
X
 
 
30119
Gap junction beta-2 protein
109
40
0
0
X
 
 
30118
Endothelial PAS domain-containing protein 1
695
505
122
0
X
 
 
30117
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30116
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30115
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30114
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
128
0
0
16
 
X
 
30113
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
128
0
0
16
 
X
 
30112
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
129
0
0
16
 
X
 
30111
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
129
0
0
16
 
X
 
30110
Antimicrobial peptide KAMP-19
87
44
18
0
X
 
 
30109
PSM Alpha1
109
0
0
0
X
 
 
30108
riboswitch (47-MER)
290
240
19
0
 
 
X
30107
Phenol-soluble modulin Beta2
201
0
0
0
X
 
 
30106
Phenol-soluble modulin Alpha 3
107
0
0
0
X
 
 
30105
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
128
0
0
16
 
X
 
30102
DNA damage-inducible protein 1
721
507
126
0
X
 
 
30101
Melanoregulin
572
533
151
0
X
 
 
30100
Myosin-binding protein C, cardiac-type
832
582
147
0
X
 
 
30099
Islet amyloid polypeptide, HI18
526
320
98
0
X
 
 
30098
Helicase-like transcription factor (E.C.3.6.4.-,6.3.2.-)
670
487
129
0
X
 
 
30097
Protein DDI1 homolog 2
578
405
103
0
X
 
 
30094
Coat protein
441
377
101
0
X
 
 
30093
Two-component sensor histidine kinase, Circadian clock protein KaiB
1179
932
200
0
X
 
 
30092
Two-component sensor histidine kinase
623
488
110
0
X
 
 
30091
Circadian clock protein KaiB
603
466
97
0
X
 
 
30090
Envelope glycoprotein gp160
37
75
37
0
X
 
 
30089
Hge-scorpine
260
0
0
0
X
 
 
30088
Immunoglobulin G-binding protein G
294
224
65
0
X
 
 
30087
Protein-lysine N-methyltransferase (E.C.2.1.1.-)
803
631
154
0
X
 
 
30086
Protein-export protein SecB, Maltose-binding periplasmic protein
1214
2550
686
0
X
 
 
30085
Protein-export protein SecB, Maltose-binding periplasmic protein
1118
2282
602
0
X
 
 
30084
Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)
1314
2350
622
0
X
 
 
30083
Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)
1250
2362
666
0
X
 
 
30082
Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)
1296
2276
640
0
X
 
 
30081
Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)
1346
2334
618
0
X
 
 
30080
Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)
1663
3011
926
0
X
 
 
30079
Uncharacterized protein
498
413
91
0
X
 
 
30078
Guanine nucleotide-binding protein G(i) subunit alpha-1
243
0
243
0
X
 
 
30077
Guanine nucleotide-binding protein G(i) subunit alpha-1
244
0
244
0
X
 
 
30076
Sodium channel protein type 4 subunit alpha
0
111
0
0
X
 
 
30075
E3 ubiquitin-protein ligase TRIM21 (E.C.6.3.2.-)
240
175
40
0
X
 
 
30074
Dynein light chain Tctex-type 1
1356
808
268
0
X
 
 
30073
Uncharacterized protein
100
17
0
0
X
 
 
30072
Plastin-2
79
239
80
0
X
 
 
30071
Plastin-2
94
284
95
0
X
 
 
30070
Uncharacterized protein
360
246
68
0
X
 
 
30069
W37
188
84
39
0
X
 
 
30068
Antivirulence protein AVR-Pia
432
152
75
0
X
 
 
30067
W35
200
76
41
0
X
 
 
30066
Putative peptidyl carrier protein
519
382
95
0
X
 
 
30065
Voltage-dependent anion-selective channel protein 1
253
466
252
0
X
 
 
30064
Choline binding protein (E.C.3.2.1.96)
257
165
49
0
X
 
 
30063
Calmodulin, Eukaryotic elongation factor 2 kinase (E.C.2.7.11.20)
951
737
183
0
X
 
 
30062
Calmodulin, Disks large homolog 4
523
440
143
0
X
 
 
30061
Fibronectin, Anastellin
555
418
91
0
X
 
 
30060
Hylin-K
110
0
0
0
X
 
 
30059
Hylin-D
102
0
0
0
X
 
 
30058
DNA (25-MER)
256
0
0
0
 
X
 
30057
Hylin-Ac
103
0
0
0
X
 
 
30056
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*GP*G)-3')
161
0
0
0
 
X
 
30055
DNA (5'-D(*GP*GP*TP*TP*TP*GP*GP*TP*TP*TP*TP*GP*GP*TP*TP*TP*GP*G)-3')
193
0
0
0
 
X
 
30054
DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')
112
0
0
18
 
X
 
30053
DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')
156
0
0
16
 
X
 
30052
DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')
144
0
0
18
 
X
 
30051
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
375
162
0
0
X
 
X
30050
Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)
497
378
76
0
X
 
 
30049
Cyclic peptide mimetic of Tat/RNA Complex
375
162
0
0
X
 
X
30048
Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)
497
378
76
0
X
 
 
30047
Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)
482
365
76
0
X
 
 
30046
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
375
162
0
0
X
 
X
30045
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')
210
0
0
0
 
X
 
30044
DNA Dodecamer with 8-oxoguanine at 10th Position
162
0
0
14
 
X
 
30042
C-X-C motif chemokine 13
525
309
91
0
X
 
 
30040
Antifreeze protein
386
317
82
0
X
 
 
30039
Antibacterial factor-related peptide 2
346
197
59
0
X
 
 
30038
DNA
162
0
0
14
 
X
 
30035
Capsid protein p24
0
603
188
0
X
 
 
30034
Uncharacterized protein
553
439
115
0
X
 
 
30033
Hge-scorpine
287
139
50
0
X
 
 
30032
Zinc finger and BTB domain-containing protein 17
148
65
22
0
X
 
 
30031
E3 ubiquitin-protein ligase Midline-1 (E.C.6.3.2.-)
313
231
52
0
X
 
 
30030
CDC48-associated ubiquitin-like/zinc finger protein 1
303
219
62
0
X
 
 
30029
General control protein GCN4
166
122
34
0
X
 
 
30028
General control protein GCN4
202
135
35
0
X
 
 
30027
General control protein GCN4
213
114
36
0
X
 
 
30026
5'-terminal hairpin of the 7SK snRNA
256
68
23
0
 
 
X
30025
SdrG
667
499
121
0
X
 
 
30024
RaCI2
339
203
62
0
X
 
 
30023
Sensory transduction regulatory protein
672
502
123
0
X
 
 
30022
Lactoferrin
165
0
0
0
X
 
 
30021
Mitochondrial Calcium Uniporter
136
385
136
0
X
 
 
30020
beta-galactosidase 1
653
444
114
0
X
 
 
30019
E3 ubiquitin-protein ligase UHRF1 (E.C.6.3.2.-), Spacer
822
421
152
0
X
 
 
30017
Protein S100-A9
568
435
98
0
X
 
 
30016
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')
187
0
0
0
 
X
 
30015
DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')
190
0
0
0
 
X
 
30013
Lactoferrin
165
0
0
0
X
 
 
30012
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')
218
0
0
0
 
X
 
30011
W7A mu-TRTX-Pre1a Toxin
225
155
36
0
X
 
 
30010
Myc box-dependent-interacting protein 1, CHIKV nsP3 peptide
610
334
105
0
X
 
 
30009
mu-TRTX-Pre1a toxin
228
161
38
0
X
 
 
30008
Nucleocapsid protein p7
42
125
42
0
X
 
 
30007
Type I modular polyketide synthase
432
348
93
0
X
 
 
30006
Type I modular polyketide synthase
541
315
92
0
X
 
 
30005
Protein phosphatase 1 regulatory subunit 12A
298
206
50
0
X
 
 
30004
CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)
945
509
153
0
X
 
 
30003
CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)
724
385
122
0
X
 
 
30002
Cellular tumor antigen p53,CREB-binding protein (E.C.2.3.1.48)
988
531
162
0
X
 
 
30000
DE NOVO DESIGNED PROTEIN OR258
810
594
130
0
X
 
 
27281
N15alphabetaTCR, pTalpha/N15beta
209
598
209
0
X
 
 
27280
N15alphabetaTCR, pTalpha/N15beta
206
593
206
0
X
 
 
27279
N30alphabetaTCR, pTalpha/N30beta
213
610
213
0
X
 
 
27278
N15alphabetaTCR, pTalpha/N15beta
202
588
202
0
X
 
 
27270
pNS5A-D2
80
278
80
0
X
 
 
27267
Jun monomer
208
437
208
0
X
 
 
27265
human Cyclophilin A
887
677
167
0
X
 
 
27264
HuPrPM129
766
505
130
0
X
 
 
27261
A2A_ZM
5
5
0
0
X
 
 
27259
HuPrPG127V
780
532
147
0
X
 
 
27243
Rpt1/ini1
515
387
86
0
X
 
 
27242
Trigger factor
181
201
182
0
X
 
 
27240
ROR1 Kringle monomer
460
331
84
0
X
 
 
27239
Trigger factor
981
1107
981
0
X
 
 
27236
hTE-CCR monomer
314
324
118
0
X
 
 
27234
CAMSAP3 CKK domain
628
520
124
0
X
 
 
27232
subunit c ring of FoF1 ATP synthase
0
294
0
0
X
 
 
27231
full length Dengue NS4A
117
321
117
0
X
 
 
27214
single polypeptide chain, RSK1 phosphorylated C-terminal peptide (696-735)
35
0
35
0
X
 
 
27213
single polypeptide chain, RSK1 C-terminal peptide (696-735)
35
0
35
0
X
 
 
27212
fibrils Abeta(1-42)
0
183
48
0
X
 
 
27211
TET
149
1080
289
0
X
 
 
27208
Fc fragment of mouse immunoglobulin G
197
425
197
0
X
 
 
27201
PB6 full length
81
202
81
0
X
 
 
27196
Igdomain
95
276
95
0
X
 
 
27195
Ct-Frataxin
119
262
119
0
X
 
 
27193
Y39E EVH1
134
0
123
0
X
 
 
27191
ProXp-ala bound to microhelixPro
152
451
152
0
X
 
 
27185
ProXp-ala
156
182
156
0
X
 
 
27184
hSSB2
118
361
118
0
X
 
 
27183
EIC dimer
264
821
264
0
X
 
 
27177
Coronavirus nsp1 truncated proteins; nsp1(13-50)
318
330
112
0
X
 
 
27176
Coronavirus nsp1 truncated proteins; nsp1(13-25)
201
247
86
0
X
 
 
27173
KRAS promoter region
203
136
12
0
 
X
 
27172
Ubiquitin
73
220
73
0
X
 
 
27170
Polypeptide chain
1019
630
177
0
X
 
 
27169
solubility domain GB1
234
244
65
0
X
 
 
27166
LisH dimer
229
210
54
0
X
 
 
27162
Spred1-EVH1
617
461
117
0
X
 
 
27158
CHIKV macro domain
763
604
137
0
X
 
 
27151
hGMPK
1137
812
196
0
X
 
 
27147
NT-2Rep-CT
92
246
92
0
X
 
 
27146
hpEst3
952
676
183
0
X
 
 
27145
chromatin-associated protein swi6
55
106
55
0
X
 
 
27141
PupB-NTSD monomer
397
309
82
0
X
 
 
27136
hL-FABP:GCA
126
233
126
0
X
 
 
27135
Brr2 C-terminal Sec63 unit
231
436
231
0
X
 
 
27134
C-terminal domain of MSP2
50
98
50
0
X
 
 
27133
UNG2
857
866
312
0
X
 
 
27131
XPA98-239 monomer
137
415
137
0
X
 
 
27130
RbmA FnIII-2 domain
134
219
121
0
X
 
 
27129
hL-FABP apo
126
239
126
0
X
 
 
27127
TopN monomer
77
315
77
0
X
 
 
27126
SH2B1/JAK2-pep complex
102
102
102
0
X
 
 
27125
FUS 12E LC
151
423
151
0
X
 
 
27122
Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)
179
315
179
0
X
 
 
27121
Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)
237
404
237
0
X
 
 
27120
circAFP
69
216
69
0
X
 
 
27119
SH2B1 SH2 Domain
97
97
97
0
X
 
 
27110
env45
256
179
42
0
X
 
 
27108
NOX1 ativator
55
116
57
0
X
 
 
27106
BRM AT-BRD
131
190
131
0
X
 
 
27104
SRC-2 RID
0
642
220
0
X
 
 
27099
gp17.1 phage tail
151
460
151
0
X
 
 
27098
mth10btqqa homodimer
551
407
106
0
X
 
 
27097
mvo10b homodimer
563
426
100
0
X
 
 
27095
CaM NaV1.2 IQ motif
936
800
187
0
X
 
 
27094
CaMC NaV1.2 IQ motif
98
286
98
0
X
 
 
27093
MOZART1
371
298
77
0
X
 
 
27092
Sod2_TMXI
149
88
0
0
X
 
 
27091
EarP
236
188
237
0
X
 
 
27090
Elongation factor P
178
516
178
0
X
 
 
27089
ISCU monomer
103
211
103
0
X
 
 
27088
ISCU monomer
105
218
105
0
X
 
 
27086
single polypeptide chain
372
222
61
0
X
 
 
27085
HPF
427
435
102
0
X
 
 
27084
beta-gB1
95
0
0
0
X
 
 
27081
atg32
858
603
140
0
X
 
 
27080
UNG2
231
692
231
0
X
 
 
27079
bcl6
109
228
111
0
X
 
 
27078
ScLPMO10C
1323
1573
463
0
X
 
 
27073
NS5Bd21 monomer
20
20
0
0
X
 
 
27072
TDP-43 NTD
71
0
69
0
X
 
 
27071
BTHB
90
210
80
0
X
 
 
27070
FKBP25
207
632
207
0
X
 
 
27069
SPIN
73
192
73
0
X
 
 
27067
BlaC
248
769
248
0
X
 
 
27065
MAK33 VL amyloid fibril
0
111
34
0
X
 
 
27063
CTD27-52 monomer
108
425
108
0
X
 
 
27062
Arig2
522
349
113
0
X
 
 
27061
ACPP-monomer
77
228
77
0
X
 
 
27060
DecP-11
94
0
0
0
X
 
 
27058
MOAG-4
347
314
79
0
X
 
 
27055
RBM10_RRM2
480
291
91
0
X
 
 
27053
KRAS oncogene promoter region
218
0
0
0
 
X
 
27052
TIM9/10
162
432
163
0
X
 
 
27048
MS1
1328
1077
259
0
X
 
 
27047
Hamster PrP 90-231
46
0
46
0
X
 
 
27046
cHSP27 dimer
80
249
77
0
X
 
 
27045
HttExon1 fibrils
0
130
8
0
X
 
 
27044
Sgt2_TPR monomer
135
407
135
0
X
 
 
27043
NDM-1
182
383
182
0
X
 
 
27041
PipX monomer
439
170
84
0
X
 
 
27040
Bet v 1.0102
817
620
152
0
X
 
 
27039
P23T HGD aggregated at pH 7
0
157
39
0
X
 
 
27038
CTD
36
36
12
0
X
 
 
27037
NTD
39
39
13
0
X
 
 
27036
prr7 dissordered protein
340
273
74
0
X
 
 
27035
Ube2T (1-154)
126
399
126
0
X
 
 
27034
RCD1
675
500
123
0
X
 
 
27033
TvCyP2 monomer
933
750
175
0
X
 
 
27032
DANCER-3
247
218
56
0
X
 
 
27031
DANCER-1
205
162
56
0
X
 
 
27030
DANCER-0
245
203
47
0
X
 
 
27028
CzrA homodimer
58
58
0
0
X
 
 
27027
AcBS
255
385
126
0
X
 
 
27026
Ascl1 trascription factor
83
237
83
0
X
 
 
27025
Ascl1 trascription factor
67
208
67
0
X
 
 
27024
Ascl1 trascription factor
97
315
97
0
X
 
 
27023
Ascl1 trascription factor
67
212
67
0
X
 
 
27022
PGK:3PG:MgF3:ADP:Mg2+
385
1186
385
0
X
 
 
27020
human betaB2-crystallin dimer
162
322
162
0
X
 
 
27017
CaMCaN
1023
798
199
0
X
 
 
27015
c-NmDsbD monomer
124
255
124
0
X
 
 
27014
c-NmDsbD monomer
124
255
124
0
X
 
 
27013
n-NmDsbD monomer
128
261
128
0
X
 
 
27012
n-NmDsbD monomer
128
261
128
0
X
 
 
27003
human 4E-BP1 (fragment 44 to 87)
37
108
37
0
X
 
 
27002
HuR RRM1-RRM2
195
582
193
0
X
 
 
26998
Rabbit Prp 90-231
52
0
52
0
X
 
 
26997
human 4E-BP1 (fragment 44 to 87) bound to mouse eIF4E
36
72
36
0
X
 
 
26996
NS2B/NS3
193
332
193
0
X
 
 
26995
chd
329
249
55
0
X
 
 
26994
HSP27
31
102
31
0
X
 
 
26993
NavII
648
489
146
0
X
 
 
26992
NavII
705
503
149
0
X
 
 
26990
Regulatory domain of Calcineurin
269
376
95
0
X
 
 
26986
yTrx1
584
446
104
0
X
 
 
26984
Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein
148
412
141
0
X
 
 
26983
HBP(D24R)-histamine-serotonin
153
69
153
0
X
 
 
26981
Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein
149
417
142
0
X
 
 
26980
Wild type fused Npu DnaE from Nostoc punctiforme with Gly +2 Extein
150
417
143
0
X
 
 
26979
Wild type fused Npu DnaE from Nostoc punctiforme with Phe +2 Extein
145
417
142
0
X
 
 
26978
MeCP2-DNA
285
266
72
0
X
X
 
26977
Beta-chain labeled B4.2.3 TCR
288
698
197
0
X
 
 
26976
G alpha i3 bound to GoLoco14
93
93
0
0
X
 
 
26975
G alphai 3 bound to GDP
96
96
0
0
X
 
 
26974
Hsp31 dimer
240
763
240
0
X
 
 
26973
HCC
87
269
87
0
X
 
 
26972
SET domain of human methyltransferase NSD3
224
691
224
0
X
 
 
26971
lc-ltp2/DHPC
503
362
97
0
X
 
 
26970
lc-ltp2/DMPG
504
362
97
0
X
 
 
26966
hLTB
93
256
93
0
X
 
 
26965
Htt
32
96
32
0
X
 
 
26964
Htt
32
96
32
0
X
 
 
26963
PA-ICP
637
380
105
0
X
 
 
26962
bmAANAT3
197
601
197
0
X
 
 
26961
SUMO-specific protease 4 (SUSP4 201-300)
535
410
95
0
X
 
 
26960
MAP2c
2354
1807
464
0
X
 
 
26959
CzrA homodimer
58
58
0
0
X
 
 
26958
Prion monomer
183
532
183
0
X
 
 
26957
ICP4N
73
0
34
0
X
 
 
26956
Ca-S100A4d9-C-ERMAD complex
89
0
89
0
X
 
 
26955
SH3
60
180
60
0
X
 
 
26954
Fyn SH3 V39V/N53P/V55L delta56
57
171
57
0
X
 
 
26953
KLF4 1-130
117
379
116
0
X
 
 
26951
USP7 catalytic domain
284
872
284
0
X
 
 
26949
ERD10
822
661
237
0
X
 
 
26947
AIPL1 FKBP/FC complex
563
505
113
0
X
 
 
26946
Ca-S100A4d9
437
0
88
0
X
 
 
26945
Human SMAD4 MH1 domain
110
233
109
0
X
 
 
26944
mmTGF-b2-7m
86
271
86
0
X
 
 
26943
mmTGF-b2
86
272
86
0
X
 
 
26940
LITAF delta114-139
313
380
126
0
X
 
 
26939
ASH1-mRNA
16
0
0
0
 
 
X
26938
ASH1-mRNA
10
0
0
0
 
 
X
26937
nanobody 39
274
359
133
0
X
 
 
26936
nanobody 33
279
369
133
0
X
 
 
26935
KISS-1
225
324
103
0
X
 
 
26933
NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine aldehyde
191
592
191
0
X
 
 
26932
MTTTm monomer
145
438
145
0
X
 
 
26929
NCAM FN1
98
308
98
0
X
 
 
26928
NS2B-NS3 Protease from Zika Virus
154
476
154
0
X
 
 
26927
NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine
192
580
192
0
X
 
 
26926
ShaPrP23-144 amyloid fibrils
0
77
27
0
X
 
 
26925
huPrP23-144 amyloid fibrils
0
92
28
0
X
 
 
26924
mouse PrP23-144 amyloid fibril
0
83
30
0
X
 
 
26922
First RRM domain of MEC-8
180
214
100
0
X
 
 
26921
Cx37CT Domain
570
397
88
0
X
 
 
26920
TPR2B
122
247
122
0
X
 
 
26919
PulG
542
421
103
0
X
 
 
26916
G-CSFC3
160
481
160
0
X
 
 
26915
Spy
126
366
126
0
X
 
 
26914
UBAP1
58
48
0
0
X
 
 
26913
HET-s(218-289)
63
98
48
0
X
 
 
26912
Nrd1
724
625
138
0
X
 
 
26910
y21m protein coat monomer
0
221
52
0
X
 
 
26909
E coli DNA polymerase III delta subunit (residues 1-140)
761
587
148
0
X
 
 
26908
FliGn-FliFc
131
267
131
0
X
 
 
26907
hydrophobin from Phanerochaete carnosa
363
311
79
0
X
 
 
26906
P-CTD
159
238
81
0
X
 
 
26905
P-S23C_tetramer
506
451
149
0
X
 
 
26904
P1-163_tetramer
263
370
121
0
X
 
 
26903
P_delta[122-160]
627
592
193
0
X
 
 
26902
P1-126
234
311
119
0
X
 
 
26901
USP20
479
389
95
0
X
 
 
26894
monomeric SOD1
107
310
107
0
X
 
 
26893
monomeric SOD1
105
310
105
0
X
 
 
26889
bound chains A and B
301
179
0
0
X
 
 
26888
HBHA and Heparin
498
373
84
0
X
 
 
26887
HBHA110-199
498
373
84
0
X
 
 
26886
ferrous THB1
129
389
129
0
X
 
 
26885
Ferric THB1
127
388
127
0
X
 
 
26883
virus-like particles
0
298
121
0
X
 
 
26882
MCoAA-02
198
0
0
0
X
 
 
26881
LC3B monomer
101
0
101
0
X
 
 
26879
AL-09 VL fibrils
0
188
54
0
X
 
 
26878
VcPth-N118D mutant
183
550
183
0
X
 
 
26877
VcPth-N72D mutant
183
560
183
0
X
 
 
26876
VcPth-N14D mutant
180
552
180
0
X
 
 
26875
VcPth-H24N mutant
182
550
182
0
X
 
 
26874
rT1
132
0
0
0
X
 
 
26873
NS2B-NS3 Protease from Zika Virus
204
614
204
0
X
 
 
26871
Dpo4 Binary
348
927
294
0
X
 
 
26867
HADDOCK model of the complex between the KIX domain of CBP and the transactivation domain of p65
526
476
118
0
X
 
 
26866
PDZ domain
96
276
96
0
X
 
 
26864
ScribPDZ4withp22peptide
82
0
82
0
X
 
 
26863
ScribPDZ4apo
82
176
82
0
X
 
 
26862
Stress Response Peptide-2
130
0
0
0
X
 
 
26861
MS2
79
232
77
0
X
 
 
26860
MS1
76
231
76
0
X
 
 
26858
BASV-U1
273
395
124
0
X
 
 
26857
Lipoprotein signal peptide with globomycin
178
485
178
0
X
 
 
26855
phosducin
197
402
155
0
X
 
 
26854
AsLOV2
827
644
166
0
X
 
 
26853
LytU
805
467
136
0
X
 
 
26852
VirB8 homodimer
146
416
146
0
X
 
 
26851
COMT monomer, Sinefungin, DNC, Mg
204
639
204
0
X
 
 
26850
Im7_6-45
37
111
37
0
X
 
 
26849
Spy
87
260
87
0
X
 
 
26848
COMT monomer, SAM, DNC, Mg
205
641
205
0
X
 
 
26847
Protein Tyrosine Phosphatase 1B N193A variant in complex with TCS401
206
407
206
0
X
 
 
26843
NCP15 + Zncl2
275
296
104
0
X
 
 
26842
TMR-3_48nt-5-TAMRA
415
382
157
3
 
 
X
26841
ID3
1302
1092
365
0
X
 
 
26840
GacSperi monomer
772
568
148
0
X
 
 
26839
MLV-CAH
230
203
69
0
X
 
 
26838
Protein Tyrosine Phosphatase 1B (1-301) in complex with TCS401
221
436
221
0
X
 
 
26837
Protein Tyrosine Phosphatase 1B N193A variant
233
467
233
0
X
 
 
26836
Protein Tyrosine Phosphatase 1B L192A variant
237
469
237
0
X
 
 
26835
Protein Phosphatase 1B T178A variant
238
484
238
0
X
 
 
26834
PARP3 NTD
140
556
141
0
X
 
 
26833
alpha-N Catenin C-terminal domain
228
719
228
0
X
 
 
26832
Protein Tyrosine Phosphatase 1B YAYA (Y152A, Y153A) variant
246
494
246
0
X
 
 
26831
M337P TDP-43_267-414 Monomer
135
256
135
0
X
 
 
26830
M337V TDP-43_267-414 Monomer
136
256
136
0
X
 
 
26829
Q331K TDP-43_267-414 Monomer
136
256
136
0
X
 
 
26828
A326P TDP-43_267-414 Monomer
135
256
135
0
X
 
 
26827
A321V TDP-43_267-414 Monomer
136
256
136
0
X
 
 
26826
A321G TDP-43_267-414 Monomer
136
255
136
0
X
 
 
26825
Lunasin monomer
261
124
51
0
X
 
 
26824
Lunasin monomer
261
126
51
0
X
 
 
26823
WT TDP-43_267-414 Monomer
146
403
144
0
X
 
 
26822
a1I_E317A monomer
166
475
166
0
X
 
 
26821
apoTrpR
349
218
90
0
X
 
 
26820
Lunasin monomer 16-43
153
81
29
0
X
 
 
26819
CHIP-TPR/Hsp70p1
121
362
121
0
X
 
 
26818
CHIP-TPR
625
479
124
0
X
 
 
26816
TDP-43-C
145
391
145
0
X
 
 
26815
HSC70-NBD / ADP
345
1057
341
0
X
 
 
26814
Protein Tyrosine Phosphatase 1B residues 1-284
223
443
223
0
X
 
 
26813
Rhodopsin
0
36
0
0
X
 
 
26812
Rhodopsin
0
36
0
0
X
 
 
26811
rhodopsin
0
4
0
0
X
 
 
26810
LIN54
65
176
62
0
X
 
 
26809
Npm Tail Monomer
170
174
52
0
X
 
 
26808
Egr-1 DNA complex
512
366
109
0
X
X
 
26807
The Egr-1 zinc-finger protein
519
368
110
0
X
 
 
26806
Tom1-VHS
124
380
124
0
X
 
 
26805
human aquaporin 1
0
744
207
0
X
 
 
26804
POTRA1-5
319
0
319
0
X
 
 
26803
CEACAM1-Igv homodimer
83
247
83
0
X
 
 
26802
Cold Shock Protein A
432
322
84
0
X
 
 
26801
NFU1
1154
680
196
0
X
 
 
26800
VapC family toxin
799
625
143
0
X
 
 
26799
Assembly
77
0
0
0
X
 
 
26798
Assembly
76
0
0
0
X
 
 
26797
Assembly
81
0
0
0
X
 
 
26796
Assembly
80
0
0
0
X
 
 
26795
Assembly
82
0
0
0
X
 
 
26794
Assembly
82
0
0
0
X
 
 
26793
monomer
48
85
48
0
X
 
 
26792
monomer
81
162
81
0
X
 
 
26791
holo_LangCRD
247
463
150
0
X
 
 
26790
AvBD7
289
0
0
0
X
 
 
26789
CheY3_ph7.3_nomg
526
421
106
0
X
 
 
26788
Whirlin
214
652
214
0
X
 
 
26787
RIT1-assembly
128
418
128
0
X
 
 
26786
pElk1
94
318
94
0
X
 
 
26782
USP7 - ICP0 complex
187
563
187
0
X
 
 
26780
IL36A
834
645
144
0
X
 
 
26779
Cdc25B monomer
143
467
143
0
X
 
 
26778
CheY3_noBeF3_pH4.5
673
511
126
0
X
 
 
26777
CheY3_BeF3_pH4.5
692
538
125
0
X
 
 
26776
CheY3_BeF3_pH7.25
660
509
117
0
X
 
 
26775
PfSUMO
470
355
93
0
X
 
 
26774
ribosomal protein S1
886
662
157
0
X
 
 
26773
a17
241
368
123
0
X
 
 
26772
Core8
80
243
80
0
X
 
 
26771
C. elegans TDP2 Ubiquitin Association domain
257
232
59
0
X
 
 
26770
CP12 reduced
381
263
85
0
X
 
 
26769
CheY3_noBeF3_pH7.4
644
494
112
0
X
 
 
26768
NSD2
206
629
206
0
X
 
 
26767
NSD1
212
612
212
0
X
 
 
26766
USP7
279
883
279
0
X
 
 
26765
Skp1
710
583
137
0
X
 
 
26764
hTRF1
102
139
50
0
X
 
 
26763
STARD6-testosterone complex
201
608
201
0
X
 
 
26762
Elk1
97
321
97
0
X
 
 
26761
XlnB2
146
446
147
0
X
 
 
26760
apo-EhCaBP6
625
345
123
0
X
 
 
26759
NSD2 C16
189
584
189
0
X
 
 
26758
p38 gamma
154
491
154
0
X
 
 
26755
NHE1
113
381
113
0
X
 
 
26754
PHD domain of human BAZ2A
53
160
53
0
X
 
 
26752
hSSB1
116
350
116
0
X
 
 
26751
2B4 TCR
282
827
282
0
X
 
 
26750
MycG-MIV complex
288
562
285
0
X
 
 
26748
Met-1 Human Ang
624
469
112
0
X
 
 
26746
GNAI1 monomer
283
962
282
0
X
 
 
26745
SrtC1 monomer
339
310
192
0
X
 
 
26744
TrmK
222
660
222
0
X
 
 
26743
EeCentrocin 1
162
114
31
0
X
 
 
26742
PHD2-Zn(II)-2OG-CODD
170
543
170
0
X
 
 
26741
PHD2-Zn(II)-2OG
183
564
183
0
X
 
 
26739
SipD
114
114
0
0
X
 
 
26738
human Ca2+-bound mS100A9 (C3S) homodimer
568
435
98
0
X
 
 
26735
LARA3
111
359
111
0
X
 
 
26734
PAF D53S-D55S
227
103
54
0
X
 
 
26733
p38g monomer
267
769
281
0
X
 
 
26732
p38g monomer
116
116
0
0
X
 
 
26731
Paired domain of Pax5 in complex with DNA
135
424
135
0
X
X
 
26730
Paired domain of Pax5
137
431
137
0
X
 
 
26728
C-terminal domain of TDP-43
145
390
145
0
X
 
 
26727
Doublecortin C-terminal domain monomer
109
417
108
0
X
 
 
26726
Extracellular Adherence Protein
92
181
92
0
X
 
 
26725
MtRpsA_S4
559
355
87
0
X
 
 
26724
Tcb2-C
569
457
106
0
X
 
 
26723
Tcb2-C
567
450
101
0
X
 
 
26722
PhyR
255
497
252
0
X
 
 
26721
RXFP1(1-72)
132
198
66
0
X
 
 
26718
Domain Swapped HIV RNase H
122
239
122
0
X
 
 
26717
NcLPMO9C
963
860
220
0
X
 
 
26716
GB1
64
56
60
0
X
 
 
26715
beta-endorphin
26
146
32
0
X
 
 
26709
linear diubiquitin
132
255
132
0
X
 
 
26708
NEMO
75
148
75
0
X
 
 
26706
Fibrils
0
109
37
0
X
 
 
26705
SAMSAM monomer
114
360
114
0
X
 
 
26703
RDPheH25-117
71
152
70
0
X
 
 
26702
NS5A-D1D2D3
147
469
147
0
X
 
 
26701
T-STAR KH
101
0
101
0
X
 
 
26700
Sam68 STAR
144
0
144
0
X
 
 
26698
rNedd4 WW3 Domain
212
133
38
0
X
 
 
26697
CSE4 (CENP-A) protein
765
901
218
0
X
 
 
26695
S1-DHFR-N
131
407
131
0
X
 
 
26694
S1-DHFR-NT
142
440
142
0
X
 
 
26693
DHFR-apo
97
276
97
0
X
 
 
26692
Amyloid Beta fibril
0
169
44
0
X
 
 
26691
ZnF-Bcd1
261
186
43
0
X
 
 
26690
protein + bound peptide
528
408
88
0
X
 
 
26688
Mg2+ -bound myrGCAP1 (V77E) mutant
188
283
113
0
X
 
 
26687
CaM34-iNOS
740
419
144
0
X
 
 
26686
CaM34
135
0
135
0
X
 
 
26685
CaM12
144
0
144
0
X
 
 
26684
Chica
67
199
67
0
X
 
 
26683
CaM34
138
0
138
0
X
 
 
26682
CaM12
143
0
143
0
X
 
 
26681
CaM1234
601
266
142
0
X
 
 
26680
pEAbeta(3-42)
140
112
41
0
X
 
 
26679
pEAbeta(3-42)
40
79
40
0
X
 
 
26678
Amyloid-beta(1-42)
41
83
41
0
X
 
 
26677
CP2
43
22
11
0
X
 
 
26676
CP1
48
23
12
0
X
 
 
26675
GVIIJ_SSEA
165
0
0
0
X
 
 
26674
GVIIJ[C24S]
180
63
31
0
X
 
 
26672
FUS LC monomer
145
408
145
0
X
 
 
26664
UBXD1-N
178
196
91
0
X
 
 
26663
c-Myc
71
236
83
0
X
 
 
26662
c-Myc
71
235
76
0
X
 
 
26661
src-6'-sialyllactose
738
515
125
0
X
 
 
26660
src-lactose
771
552
140
0
X
 
 
26659
src
640
441
132
0
X
 
 
26658
SczA homodimer
157
461
157
0
X
 
 
26657
MERS-CoV macro domain
734
578
158
0
X
 
 
26656
Full-length HIV-1 Transactivator of Transcription
215
326
105
0
X
 
 
26655
emerin 67-170
96
202
96
0
X
 
 
26654
emerin 67-170
95
304
95
0
X
 
 
26653
Nogo-A-Delta20
237
352
170
0
X
 
 
26652
Akt_PHD in complex with Calmodulin
85
92
85
0
X
 
 
26651
Akt_PHD
97
197
97
0
X
 
 
26650
SIX3_HD
377
260
62
0
X
 
 
26649
IF1 monomer
372
269
70
0
X
 
 
26647
p65 DBD
457
296
151
0
X
 
 
26646
mini H2-Ld
170
506
170
0
X
 
 
26645
single polypeptide chain
105
308
104
0
X
 
 
26644
N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit
203
610
203
0
X
 
 
26643
GBD-Nck
136
264
88
0
X
 
 
26642
Envoplakin PRD
184
562
184
0
X
 
 
26641
MurD monomer
371
0
371
0
X
 
 
26640
alpha B crystallin
56
138
55
0
X
 
 
26639
CBP-ID4
160
604
205
0
X
 
 
26638
apolipophorin III
698
625
185
0
X
 
 
26637
dengue virus NS4B N-terminal 125 amino acids
445
505
119
0
X
 
 
26636
ERD14
142
0
142
0
X
 
 
26635
human K-Ras4B-GDP
171
0
171
0
X
 
 
26634
protein alone
525
405
87
0
X
 
 
26632
Protein G Domain Beta-1 Sequence H
57
167
57
0
X
 
 
26631
MATH-PUC
130
375
128
0
X
 
 
26630
Protein G Domain Beta-1 Wild-Type
56
165
56
0
X
 
 
26629
MATH
134
270
127
0
X
 
 
26628
HuR RRM1-2
153
0
153
0
X
 
 
26627
CaM+Fas47-83
267
376
179
0
X
 
 
26626
CaM+Fas
148
276
146
0
X
 
 
26625
ASAP1 PH domain
99
1
97
0
X
 
 
26624
integrin beta1 TM/CT
69
188
69
0
X
 
 
26623
integrin beta3 TM/CT
71
183
70
0
X
 
 
26620
Barnase-dCGAC
164
55
109
0
X
X
 
26619
Barnase monomer
161
264
106
0
X
 
 
26618
ORP
503
476
114
0
X
 
 
26617
NaK tetramer
79
199
77
0
X
 
 
26616
CBP-ID4
160
607
205
0
X
 
 
26615
SUR2A NBD1-MgATP complex
173
490
173
0
X
 
 
26614
MxiH
0
378
78
0
X
 
 
26611
active domains of the type II topoisomerases
223
648
223
0
X
 
 
26610
active domains of the type II topoisomerases
223
652
223
0
X
 
 
26609
active domains of the type II topoisomerases
204
612
204
0
X
 
 
26608
active domains of the type II topoisomerases
204
607
204
0
X
 
 
26607
NmFic
172
524
172
0
X
 
 
26604
ubiquitin (microcrystal)
66
203
66
0
X
 
 
26603
Microtubule-associated protein light chain 3C (LC3C)
800
593
131
0
X
 
 
26602
D10alphabetaTCR, pTalpha/D10beta
192
554
192
0
X
 
 
26601
N30alphabetaTCR, pTalpha/N30beta
207
606
207
0
X
 
 
26600
N15alphabetaTCR, pTalpha/N15beta
198
580
198
0
X
 
 
26599
THAP11 coiled-coil dimer
66
130
66
0
X
 
 
26598
DNA gyrase B subunit
218
636
218
0
X
 
 
26597
DNA gyrase B
218
629
218
0
X
 
 
26595
hTRF1-DnaK complex
42
120
42
0
X
 
 
26594
hTRF1 monomer
48
141
48
0
X
 
 
26593
Obscurin Ig59
442
356
94
0
X
 
 
26592
LcrG
58
121
58
0
X
 
 
26591
PcrG9-76
74
145
75
0
X
 
 
26590
cTEM-19m
229
419
229
0
X
 
 
26589
yAAC3
256
669
256
0
X
 
 
26588
ROQ-SELEX consensus hexa-loop RNA
145
0
130
0
X
 
X
26587
ROQ-Ox40hexa-loop RNA
144
296
144
0
X
 
X
26586
TEM-1(M68L-M69T)
247
458
248
0
X
 
 
26582
Cyanobacterialchrome GAF domain
971
731
196
0
X
 
 
26580
nuclear egress subunit M50 from murine cytomegalovirus
774
632
162
0
X
 
 
26579
hLCN2-R-NTD
316
255
88
0
X
 
 
26578
cytochrome c
109
0
102
0
X
 
 
26577
Cyanobacteriochrome GAF6012g4
301
463
157
0
X
 
 
26576
Medin
44
0
44
0
X
 
 
26575
Gli3_1_90
86
256
86
0
X
 
 
26574
GAT
88
271
88
0
X
 
 
26573
TBD
47
142
47
0
X
 
 
26571
EhCaBP6
545
306
144
0
X
 
 
26570
SOD1 monomer
673
546
136
0
X
 
 
26569
TCR 3c8m t55a, TCR alpha
200
624
200
0
X
 
 
26568
The structure of the SOLE element of oskar mRNA
251
213
38
30
 
 
X
26565
Notch1 transmembrane segement
46
137
46
0
X
 
 
26564
DbhS C31S monomer
331
868
276
0
X
 
 
26562
major mite allergen Der p 23
193
139
41
0
X
 
 
26558
FNIII7-8
852
682
170
0
X
 
 
26557
alpha-synuclein
113
237
114
0
X
 
 
26554
K2
217
150
44
0
X
 
 
26553
Solution Structure of the Smarc Domain
706
333
110
0
X
 
 
26552
PfIMP1 monomer
916
693
145
0
X
 
 
26551
p73 DNA binding domain
175
573
175
0
X
 
 
26550
Mouse ASC PYD
0
395
89
0
X
 
 
26549
NS5A D2D3
433
689
235
0
X
 
 
26548
HpDnaB_Nter
0
499
112
0
X
 
 
26547
PLK4-PB3/STIL-CC
70
154
70
0
X
 
 
26546
SpaO-OrgB
151
432
151
0
X
 
 
26545
Prostate associated gene 4 phosphorylated
369
353
88
0
X
 
 
26544
Prostate associated gene 4
365
341
88
0
X
 
 
26543
SpaO
150
446
150
0
X
 
 
26541
FimH-CRD
191
510
173
0
X
 
 
26538
Short hydrophobic peptide, 11mer, SS
21
0
0
0
X
 
 
26537
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
26536
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
26535
PmrA-DNA complex
299
502
200
0
X
 
 
26534
FtsXECL1 monomer
646
540
122
0
X
 
 
26532
PmrA dimer
295
684
193
0
X
 
 
26531
EDN
120
210
122
0
X
 
 
26530
SPM
570
460
154
0
X
 
 
26529
WHB in complex with UBCH10
85
227
85
0
X
 
 
26528
UBCH10 in complex with WHB
136
367
136
0
X
 
 
26527
WHB
85
230
85
0
X
 
 
26526
UBCH10
135
367
135
0
X
 
 
26518
putative transfer protein TraH from Gram-positive conjugative plasmid pIP501
793
563
147
0
X
 
 
26517
TAM DOMAIN OF TIP5_BAZ2A
694
392
107
0
X
 
 
26512
a-spectrin
0
13
0
0
X
 
 
26509
PHF6-ePHD1
624
464
127
0
X
 
 
26069
HPV 16 E7 CR3
56
108
37
0
X
 
 
26068
DNA-binding HU protein
163
251
94
0
X
 
 
26066
PawS Derived Peptide 20 (PDP-20)
87
39
13
0
X
 
 
26065
PawS Derived Peptide 21 (PDP-21)
75
36
12
0
X
 
 
26064
PawS Derived Peptide 22 (PDP-22)
90
43
11
0
X
 
 
26063
dermcidin peptide DCD-1L
247
0
45
0
X
 
 
26062
toxin ISTX-I from Ixodes scapularis
231
126
0
0
X
 
 
26061
MAL/TIRAP TIR domain
528
419
104
0
X
 
 
26060
AF9 yeats domain in complex with histone H3 crotonylation at K18
863
665
123
0
X
 
 
26059
AF9 yeats domain in complex with histon H3 acetylation at K18
870
666
123
0
X
 
 
26058
d58CI dimer
117
246
117
0
X
 
 
26057
Mutant of BMAP-28(1-18)
107
57
0
0
X
 
 
26056
HELATX1
126
0
0
0
X
 
 
26055
BMAP-28(1-18)
107
34
7
0
X
 
 
26054
omega-agatoxin IVA
262
0
48
0
X
 
 
26053
MapZ_SY
561
426
113
0
X
 
 
26052
MapZ_QG
697
557
137
0
X
 
 
26051
DK17 IN TBLE LUVS
107
0
0
0
X
 
 
26050
DK17 IN POPC:POPG:CHOLESTEROL:GM1 LUVS
108
0
0
0
X
 
 
26049
DK17 IN GM1 LUVS
107
0
0
0
X
 
 
26048
H-NOX Monomer
775
603
149
0
X
 
 
26047
Lysine dimethylated FKBP12
675
494
109
0
X
 
 
26046
EEH_04
229
109
43
0
X
 
 
26045
HHH_06
273
155
49
0
X
 
 
26044
D1 CDTa
201
642
201
0
X
 
 
26043
BRD4 ET domain with NSD3_3 peptide
561
321
81
0
X
 
 
26042
BRD4 ET with LANA
584
350
96
0
X
 
 
26041
BRD4 ET with NSD3_1
565
329
82
0
X
 
 
26040
pseudin-2 analog (Ps-P)
134
0
0
0
X
 
 
26038
WWWKYE21 in LPS
155
0
0
0
X
 
 
26037
RWS21 in LPS micelles
127
0
0
0
X
 
 
26036
KYE21 in LPS
131
0
0
0
X
 
 
26035
membrane proximal external region of HIV-1 gp41 in hexafluoroisopropanol
247
100
0
0
X
 
 
26034
membrane proximal external region of HIV-1 gp41 in DPC micelles
256
87
0
0
X
 
 
26033
r(CGG) motif
42
0
0
0
 
 
X
26032
r(CGG) motif
38
0
0
0
 
 
X
26031
BOLA3 from Homo sapiens
508
351
87
0
X
 
 
26030
Protein kinase G (PknG) 74-147 rubredoxin domain reduced, metal bound form
100
224
63
0
X
 
 
26029
Protein kinase G (PknG) 74-147 rubredoxin domain oxidized, metal free form
44
154
44
0
X
 
 
26028
Protein kinase G (PknG) 1-147 natively disordered region + rubredoxin domain reduced, metal bound form
124
394
115
0
X
 
 
26027
Protein kinase G (PknG) 1-75 natively disordered region
83
170
53
0
X
 
 
26026
PriC DNA replication restart protein
634
568
134
0
X
 
 
26025
Q4DY78 monomer
618
451
106
0
X
 
 
26024
RNA (28-MER)
184
78
11
0
 
 
X
26022
translation initiation factor IF1
509
376
83
0
X
 
 
26021
Sr33 Coiled-coil domain
701
506
120
0
X
 
 
26016
Ca2+-bound C2 domain in complex with V5-pHM peptide
831
604
148
0
X
 
 
26012
N-terminal Domain of Human Cdc37
477
501
117
0
X
 
 
26011
Hop TPR2A monomer
828
607
131
0
X
 
 
26010
Mycobacterium tuberculosis LppM (Rv2171) protein folded domain
848
461
169
0
X
 
 
26009
Antimicrobial peptide protegrin PG-5
107
0
0
0
X
 
 
26008
N-L-idosylated Pin1 WW Domain
217
0
0
0
X
 
 
26007
N-Xylosylated Pin1 WW Domain
217
0
0
0
X
 
 
26006
N-Galactosylated Pin1 WW Domain
218
0
0
0
X
 
 
26005
N-Allosylated Pin1 WW Domain
215
0
0
0
X
 
 
26004
U5-scytotoxin-Sth1a
189
146
38
0
X
 
 
26003
U3-scytotoxin-Sth1h
183
143
32
0
X
 
 
26002
U3-scytotoxin-Sth1a
178
135
32
0
X
 
 
26001
antifungal protein sfPAFB
296
195
58
0
X
 
 
26000
delta-J-delta-K domain of EMCV IRES
274
0
0
0
 
 
X
25999
St domain of EMCV IRES
188
164
0
0
 
 
X
25998
K domain of EMCV IRES
176
167
0
0
 
 
X
25997
J domain of EMCV IRES
154
143
0
0
 
 
X
25996
J-K region of EMCV IRES
90
0
0
0
 
 
X
25995
human Rpn13 Pru domain
778
581
149
0
X
 
 
25994
designed protein E_1r26
545
311
106
0
X
 
 
25993
Human gammaC-crystallin
879
664
179
0
X
 
 
25992
MPT
211
136
41
0
X
 
 
25991
E1A-CR3
254
191
50
0
X
 
 
25990
E1A-13S
167
572
167
0
X
 
 
25989
E1A-12S monomer
737
673
222
0
X
 
 
25988
PHD domain of human BAZ2B
53
160
53
0
X
 
 
25987
transthyretin
652
381
114
0
X
 
 
25986
transthyretin
576
308
102
0
X
 
 
25985
A3B CTD
960
481
199
0
X
 
 
25984
palmitated SCP2L2
635
354
110
0
X
 
 
25983
SCP2L2
586
355
110
0
X
 
 
25982
Peptide model of 4-stranded beta-arch
189
0
0
0
X
 
 
25979
ADRM1-RPN2 complex
642
501
125
0
X
 
 
25976
fungal hydrophobin
458
379
91
0
X
 
 
25975
Geobacillus stearothermophilus IF2 G3-subdomain
537
402
110
0
X
 
 
25974
calcium-bound form of Penicillium antifungal protein (PAF)
270
0
52
0
X
 
 
25973
V26A mutant of Ubiquitin at pH 2.0
321
302
71
0
X
 
 
25972
V26A mutant of Ubiquitin at pH 6.0
320
305
70
0
X
 
 
25971
poneritoxin, omega-PONTX-Ae1a
91
46
19
0
X
 
 
25970
Acidic domain of SYNCRIP (24-140)
643
478
127
0
X
 
 
25969
minor DNA-uptake pilin ComP
677
513
115
0
X
 
 
25968
Mal d 1.0101
770
614
152
0
X
 
 
25967
ZitP zinc finger
236
164
43
0
X
 
 
25966
C-terminal extramembrane domain of SH protein
158
112
29
0
X
 
 
25965
N-terminal extramembrane domain of SH protein
80
56
15
0
X
 
 
25964
Structure of human islet amyloid polypeptide in complex with an engineered binding protein
433
354
121
0
X
 
 
25963
PDP-10
94
0
0
0
X
 
 
25962
PDP-9
95
0
0
0
X
 
 
25961
Q388A3 PDZ domain
442
276
102
0
X
 
 
25959
nigellin-1.1
209
104
0
0
X
 
 
25958
p63/p73 hetero-tetramerisation domain
1310
950
218
0
X
 
 
25957
D19S variant of the Penicillium Antifungal Protein (PAF)
252
112
60
0
X
 
 
25956
Solution structure of oxidised and zinc-bound RsrA
581
327
92
0
X
 
 
25955
Solution structure of reduced and zinc-bound RsrA
506
289
93
0
X
 
 
25954
Bt1.8 peptide
80
0
0
0
X
 
 
25953
CCHC zinc finger domain of Pcf11
397
291
77
0
X
 
 
25952
RSL
103
249
96
0
X
 
 
25951
RSLfuc
110
255
96
0
X
 
 
25950
RSLman
112
256
97
0
X
 
 
25949
Ex-4[1-27]/pl14a
216
0
0
0
X
 
 
25948
Ex-4[1-16]/pl14a
155
0
0
0
X
 
 
25947
KYE28A in lipopolysachharide
147
0
0
0
X
 
 
25946
KYE28 and lipopolysachharide
173
0
0
0
X
 
 
25945
Toca1
665
458
109
0
X
 
 
25944
AVR3a_60-147 from Phytophthora infestans
539
374
102
0
X
 
 
25943
NLRP3 PYD
518
289
84
0
X
 
 
25942
Full-length WT SOD1
603
279
158
0
X
 
 
25941
retro-KR-12
85
0
0
0
X
 
 
25939
K2 lobe of double-knot toxin
180
0
0
0
X
 
 
25935
Membrane-bound mouse CD28 cytoplasmic tail
278
188
48
0
X
 
 
25934
Nizp1-C2HR zinc finger
241
0
37
0
X
 
 
25933
NSD1-PHD_5-C5HCH tandem domain
525
366
93
0
X
 
 
25932
P441A Mutant of the Cytokine Receptor Common Subunit beta
42
119
41
0
X
 
 
25931
Cytokine Receptor Common Subunit beta
43
119
42
0
X
 
 
25930
Transmembrane domain of human Fas/CD95 death receptor
24
51
24
0
X
 
 
25929
Transmembrane domain of mouse Fas/CD95 death receptor
25
52
25
0
X
 
 
25928
vitamin B12 conjugate of PYY3-36
190
0
0
0
X
 
 
25927
Curli secretion specificity factor CsgE W48A/F79A mutant
611
470
116
0
X
 
 
25926
KR-12
89
0
0
0
X
 
 
25925
rv3053c from Mycobacterium tuberculosis in the oxidized state
461
360
88
0
X
 
 
25924
Drosha Quad
298
298
67
0
X
 
 
25923
BMI1-PHC2 complex
413
469
129
0
X
 
 
25922
K1
238
0
0
0
X
 
 
25921
IF7
258
226
74
0
X
 
 
25920
Integrin alphaIIb-beta3(A711P) Transmembrane Complex
116
219
76
0
X
 
 
25919
LC3 FUNDC1 complex
835
533
132
0
X
 
 
25918
Erythrobacter litoralis PhyR response regulator REC domain
729
557
131
0
X
 
 
25917
ProTx-II
196
84
33
0
X
 
 
25916
PaDBS1R1
101
75
18
0
X
 
 
25915
Photoswitchable G-quadruplex
48
34
0
0
 
X
 
25914
RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain
718
548
136
0
X
 
 
25913
RNF126 N-terminal zinc finger domain
227
183
38
0
X
 
 
25912
IscA
146
270
91
0
X
 
 
25911
VG16KRKP
76
0
0
0
X
 
 
25910
in-cell GB1
268
217
57
0
X
 
 
25909
in vitro GB1
316
251
62
0
X
 
 
25908
oxidized human cytochrome c
676
465
105
0
X
 
 
25907
reduced human cytochrome c
694
466
108
0
X
 
 
25906
Glucose as a nuclease mimic in DNA
235
0
0
0
 
X
 
25905
bromodomain of Trypanosoma brucei Bromodomain Factor 2(BDF2)
417
292
112
0
X
 
 
25904
DERA mutant (K58E-Y96W)
244
507
244
0
X
 
 
25903
Glucose in a DNA double helix
212
0
0
0
 
X
 
25902
actinin-1 EF bound to IQ
357
258
64
0
X
 
 
25901
SUMO-2 bound to phosphorylated RAP80 SIM
81
230
81
0
X
 
 
25900
NRAS Isoform 5
116
0
0
0
X
 
 
25899
RockCC
814
620
148
0
X
 
 
25898
Decoralin-NH2
71
0
0
0
X
 
 
25897
Holo F2 TnC
318
462
153
0
X
 
 
25896
Apo F2 TnC
154
441
154
0
X
 
 
25895
PARP-1_WGR_free
449
238
119
0
X
 
 
25894
PARP-1_F1F2F3-WGR-DNA_complex
444
0
444
0
X
X
 
25893
PARP-1_F3
924
545
162
0
X
 
 
25892
PARP-1_F1F2F3
332
350
332
0
X
 
 
25891
PARP-1_F1F2F3-DNA_complex
335
348
335
0
X
X
 
25890
DNA free
340
0
0
0
 
X
 
25889
F1F2 free
191
0
191
0
X
 
 
25888
F1F2-DNA complex
576
272
200
0
X
X
 
25887
SLURP-2, a secreted isoform of Lynx1
404
300
78
0
X
 
 
25886
acyl carrier protein LipD
451
375
85
0
X
 
 
25885
RBM24
594
450
104
0
X
 
 
25883
DD homodimer
475
284
96
0
X
 
 
25882
dsDNA-lomaiviticin A complex
153
0
0
0
 
X
 
25881
yeast Hit1 protein zinc finger
251
190
47
0
X
 
 
25880
N-terminus F2 TnC
86
252
86
0
X
 
 
25879
C-terminus F2 TnC
68
190
68
0
X
 
 
25878
N-terminus F2 TnC
429
259
87
0
X
 
 
25877
cecropin P1 with LPS
183
100
29
0
X
 
 
25875
C-terminus F2 TnC
304
205
66
0
X
 
 
25874
L6F polypeptide
475
0
73
0
X
 
 
25873
RSK1 peptide
44
0
44
0
X
 
 
25872
TrkA transmembrane domain
217
154
37
0
X
 
 
25871
Apo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
852
504
152
0
X
 
 
25870
Holo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
868
517
151
0
X
 
 
25869
LptE
819
587
162
0
X
 
 
25868
DA05R1
593
425
94
0
X
 
 
25867
PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES
29
0
29
0
 
 
X
25866
rNedd4 WW2 Domain
207
118
35
0
X
 
 
25865
rNedd4 WW2 Domain-Cx43CT Peptide Complex
242
119
35
0
X
 
 
25864
rNedd4 WW1 Domain
222
128
36
0
X
 
 
25863
ACT RTX domain
132
380
132
0
X
 
 
25861
DHFR-N
133
382
133
0
X
 
 
25860
DHFR
144
435
144
0
X
 
 
25859
complex between MMP-12 and synthetic triple-helical collagen
799
635
165
0
X
 
 
25858
Lacticin Q
315
0
0
0
X
 
 
25857
Aureocin A53
339
0
0
0
X
 
 
25856
translation initiation factor from Staphylococcus aureus Mu50
308
269
65
0
X
 
 
25855
Zipcode-binding-protein-1 KH3(DD)KH4 domains in complex with the RNA target UCGGACU
751
403
0
0
X
 
X
25854
Zipcode-binding-protein-1 KH3KH4(DD) domains in complex with the RNA target CACACCC
751
403
0
0
X
 
X
25853
spider toxin, U33-theraphotoxin-Cg1c
436
290
79
0
X
 
 
25852
CaM-eNOS
814
415
144
0
X
 
 
25851
TRIM24 PHD-Bromo
312
327
154
0
X
 
 
25850
DA05
613
440
104
0
X
 
 
25849
Gbx1[E17R,R52E]
394
298
76
0
X
 
 
25848
spider toxin pi-hexatoxin-Hi1a
448
299
75
0
X
 
 
25847
cyclic PVIIA
202
93
41
0
X
 
 
25846
In silico designed antimicrobial peptide Lavracin
122
0
0
0
X
 
 
25845
CYSTEIN KNOT WITH 2FP INTEGRIN AVB6 CANCER RECOGNITION SITE
67
0
0
0
X
 
 
25844
CYSTEIN KNOT WITH INTEGRIN AVB6 CANCER RECOGNITION SITE
67
0
0
0
X
 
 
25840
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
51
0
0
0
 
X
 
25839
YgaU
881
658
160
0
X
 
 
25838
A3CT monomer
119
153
79
0
X
 
 
25837
chromodomain 3 (CD3) of cpSRP43
342
242
67
0
X
 
 
25836
OtTx1a - ICK
254
130
55
0
X
 
 
25835
OtTx1a - AMP in DPC micelles
287
125
0
0
X
 
 
25834
FHA domain of TbPar42
968
724
172
0
X
 
 
25833
p75NTR DD:RIP2 CARD
1159
675
225
0
X
 
 
25832
CPR3
818
673
164
0
X
 
 
25831
complex of microRNA 20b pre-element with Rbfox RRM
746
566
115
0
X
 
X
25830
Lipid Transfer Protein From Pea Pisum Sativum
509
379
96
0
X
 
 
25829
p75NTR DD:RhoGDI
1403
878
257
0
X
 
 
25828
RIP2 CARD
648
372
122
0
X
 
 
25827
metal-binding domain 1 of ATP7B
335
293
72
0
X
 
 
25826
microRNA 20b pre-element
175
153
0
0
 
 
X
25825
UBL protein
563
404
98
0
X
 
 
25820
Peptide PG-990
78
0
0
0
X
 
 
25819
Leptospiral LigA4 Big Domain
372
233
100
0
X
 
 
25818
transmembrane domain of human nicastrin in DPC micelles
192
120
45
0
X
 
 
25817
transmembrane domain of human nicastrin in SDS micelles
202
128
44
0
X
 
 
25816
PDZ domain
440
276
102
0
X
 
 
25814
Peptide PG-990 in DPC micelles
72
0
0
0
X
 
 
25813
Peptide PG-989
72
0
0
0
X
 
 
25811
core of the U4/U6 di-snRNA
30
5
25
0
 
 
X
25810
N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9
541
352
116
0
X
 
 
25809
W60G_beta2-microglobulin
427
375
99
0
X
 
 
25808
KIAA0323 binding with NEDD8
118
0
120
0
X
 
 
25807
B3 domain of protein G
218
132
55
0
X
 
 
25806
prolactin receptor transmembrane domain
176
161
37
0
X
 
 
25805
cyclic nucleotide-binding homology domain of hERG channel
687
508
125
0
X
 
 
25804
muO-conotoxin MfVIA
187
98
22
0
X
 
 
25803
UBL domain of the yeast DNA damage-inducible protein homolog 1
500
360
89
0
X
 
 
25802
CD302
832
627
151
0
X
 
 
25801
UBL domain of the human DNA damage-inducible protein homolog 2
471
332
83
0
X
 
 
25800
Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNA
374
398
84
0
X
 
X
25799
human I-type lectin domain-glycan complex
912
623
154
0
X
 
 
25798
human Siglec-8
870
620
158
0
X
 
 
25797
cardiac troponin C
460
281
91
0
X
 
 
25796
complex of PEP-19 bound to the C-domain of apo calmodulin
616
430
112
0
X
 
 
25793
RNA-Binding domain of non-structural protein 1 from the 1918 H1N1 influenza virus
384
311
71
0
X
 
 
25792
p65dd/p50dd
106
222
106
0
X
 
 
25791
kinase in complex with its regulatory protein
859
611
155
0
X
 
 
25790
polyQ regulatory protein
442
289
83
0
X
 
 
25789
CmPI-II, a serin protease inhibitor
236
170
55
0
X
 
 
25788
Influenza-A M2
80
250
59
0
X
 
 
25787
salicylate-loaded ArCP from yersiniabactin synthetase
481
345
81
0
X
 
 
25786
holo ArCP from yersiniabactin synthetase
484
371
81
0
X
 
 
25785
CssA5 (middle region) of CssA thermometer
204
32
18
0
 
 
X
25784
CssA Thermometer from Neisseria meningitidis
287
31
26
0
 
 
X
25783
Astexin3
131
73
0
0
X
 
 
25782
Lasso peptide Astexin2-dC4
106
59
0
0
X
 
 
25781
CssA3 (top stem) of CssA thermometer
231
67
14
0
 
 
X
25780
CssA4 (bottom stem) of CssA thermometer
215
76
17
0
 
 
X
25778
spider toxin U4-hexatoxin-Hi1a
448
322
80
0
X
 
 
25777
Tetrahymena telomerase RNA pseudoknot
184
80
0
0
 
 
X
25776
Outer Membrane Protein G P92A mutant
155
488
155
0
X
 
 
25775
spider-venom peptide Hm1a
197
107
38
0
X
 
 
25774
spider toxin, U4-agatoxin-Ao1a
171
124
31
0
X
 
 
25773
Trappin-2
556
401
95
0
X
 
 
25772
Elafin
334
0
0
0
X
 
 
25771
Cementoin
224
0
0
0
X
 
 
25770
N_Est2
676
521
138
0
X
 
 
25769
frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]
96
0
0
0
X
 
 
25768
Outer Membrane Protein G from Pseudomonas aeruginosa
181
558
181
0
X
 
 
25767
Vta1NTD-Did2(176-204) complex
1062
688
185
0
X
 
 
25766
Zmp1
1140
804
221
0
X
 
 
25765
2-stranded parallel beta-sheet
101
0
0
0
X
 
 
25764
2-stranded parallel beta-sheet
108
0
0
0
X
 
 
25763
MbtH-like protein from Mycobacterium avium
268
235
62
0
X
 
 
25762
Pleiotrophin
540
533
127
0
X
 
 
25761
PC07372D
585
355
107
0
X
 
 
25760
GNPTAB
973
679
179
0
X
 
 
25759
Quercetin complexed with c-myc G-quadruplex DNA
57
0
0
0
 
X
 
25758
de-novo toxin Hui1
179
49
31
0
X
 
 
25757
calmodulin-connexin36
657
596
152
0
X
 
 
25756
Src catalytic domain
179
540
179
0
X
 
 
25755
non-sweet mutant (ins18RI19) of sweet protein Brazzein
327
159
59
0
X
 
 
25754
LASSO peptide Astexin1
136
73
0
0
X
 
 
25753
sweeter mutant (D40K) of sweet protein Brazzein
321
156
57
0
X
 
 
25751
VG16KRKP_DIMER
92
0
0
0
X
 
 
25750
CIN85 CC-domain trimer
221
277
79
0
X
 
 
25749
C4VG16KRKP
91
0
0
0
X
 
 
25748
ddFLN5+110
204
271
122
0
X
 
 
25746
DNA G-quadruplex
114
0
0
0
 
X
 
25745
N-terminal domain of the metalloprotease PrtV from Vibrio cholerae
449
357
79
0
X
 
 
25744
RpfC
380
227
72
0
X
 
 
25743
Baz1a-bromodomain
591
338
112
0
X
 
 
25742
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
176
104
25
0
X
 
 
25741
octyl-tridecaptin A1 in DPC micelles containing Gram-negative lipid II
73
0
0
0
X
 
 
25740
C-terminal domain of Cdc37 cochaperone
495
351
86
0
X
 
 
25737
octyl-tridecaptin A1
75
0
0
0
X
 
 
25736
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
175
114
24
0
X
 
 
25735
The selective autophagy receptor TAX1BP1 is required for autophagy-dependent capture of cytosolic Salmonella typhimurium
402
179
63
0
X
 
 
25734
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
345
174
49
0
X
 
 
25732
PetP
453
347
83
0
X
 
 
25731
phosphoenolpyruvate-Enzyme I complex from the bacterial hosphotransferase system
95
0
95
0
X
 
 
25730
H-Ras G12V
160
482
160
0
X
 
 
25729
EGFR transmembrane and juxtamembrane domains
327
246
57
0
X
 
 
25728
HBPd24r
217
360
151
0
X
 
 
25727
HBPd24r bound to histamine
229
381
160
0
X
 
 
25726
R4 peptide
57
0
0
0
X
 
 
25725
cystein-rich peptide jS1
151
0
0
0
X
 
 
25724
Control DNA oligonucleotide for the universal base
133
0
0
16
 
X
 
25723
Universal Base oligonucleotide with UB at point 5
136
0
0
16
 
X
 
25722
KIAA0323 binding preference for NEDD8
153
0
50
0
X
 
 
25721
VirA DD
223
157
43
0
X
 
 
25720
Regnase-1 C-terminal domain
350
268
58
0
X
 
 
25719
Regnase-1 Zinc finger domain
195
111
26
0
X
 
 
25718
Regnase-1 N-terminal domain
278
214
50
0
X
 
 
25717
PltL-pyrrolyl
570
313
90
0
X
 
 
25716
pyoluteorin type II pep-tidyl carrier protein PltL, holo form
567
402
92
0
X
 
 
25715
HLA-B2709_TIS
252
767
252
0
X
 
 
25714
HLA-B2705_pVIPR
247
719
247
0
X
 
 
25713
HLA-B2709_pVIPR
255
758
255
0
X
 
 
25712
dehydroascorbate reductase 3A from Populus trichocarpa
925
542
207
0
X
 
 
25711
HLA-B2705_TIS
241
251
241
0
X
 
 
25710
high-density lipoprotein particles
149
391
149
0
X
 
 
25709
Ub S65E in complex with parkin R0RBR
38
38
0
0
X
 
 
25708
Ub S65E
74
45
74
0
X
 
 
25707
Ub in complex with parkin R0RBR
45
45
0
0
X
 
 
25706
VirA VirFG fusion
422
321
80
0
X
 
 
25705
N-NTD
212
637
212
0
X
 
 
25704
lasso peptide chaxapeptin
99
79
16
0
X
 
 
25703
oxidized form of thioredoxin 1 from Sacharomyces cerevisiae
530
421
101
0
X
 
 
25702
reduced form of thioredoxin 1 from Sacharomyces cerevisiae
485
380
102
0
X
 
 
25700
R. palustris CsgH
492
399
99
0
X
 
 
25699
N-terminal membrane-anchoring region of the glycosyltransferase WaaG
193
84
0
0
X
 
 
25698
hCFTR NBD1 deltaRI F508del
185
375
186
0
X
 
 
25697
hCFTR NBD1 deltaRI I539T
218
581
206
0
X
 
 
25696
hCFTR NBD1 deltaRI
201
585
201
0
X
 
 
25694
CXCL12-CXCR4
661
452
110
0
X
 
 
25693
xcL1
337
257
62
0
X
 
 
25692
OVIS ARIES PRP
716
0
148
0
X
 
 
25691
kallikrein inhibitor SPINK6
237
0
55
0
X
 
 
25690
eukaryotic elongation factor 1B monomer
773
579
137
0
X
 
 
25689
TolAIII
652
477
123
0
X
 
 
25688
Acyl Carrier Protein monomer
425
229
78
0
X
 
 
25686
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
209
0
0
0
 
X
 
25685
Transmembrane Electron Transporter CcdA
158
451
156
0
X
 
 
25684
LIPID DROPLET ANCHORING PEPTIDE OF CGI-58
177
125
37
0
X
 
 
25683
T456Y
214
0
0
0
X
 
 
25682
T456D
208
0
0
0
X
 
 
25681
E454Y
171
25
4
0
X
 
 
25680
L453W
207
0
0
0
X
 
 
25679
L453E
170
30
0
0
X
 
 
25678
L453D
204
0
0
0
X
 
 
25677
CBX8 in complex with AF9
452
406
88
0
X
 
 
25676
NS4A_mut
41
134
41
0
X
 
 
25675
N-TERMINAL DOMAIN OF TDP-43
481
351
93
0
X
 
 
25674
MALT1 subunit 1
272
864
272
0
X
 
 
25673
3-stranded parallel beta-sheet
148
0
0
0
X
 
 
25672
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
184
0
0
0
 
X
 
25671
HIV ISS element
172
0
0
0
 
 
X
25670
Enterocin HF
203
0
0
0
X
 
 
25669
self complementary Xylonucleic Acid duplex
74
72
0
7
 
 
X
25668
Q343R Mutant of TDP-43 Amyloidogenic Core Region
116
106
42
0
X
 
 
25667
G335D Mutant of TDP-43 Amyloidogenic Core Region
139
118
46
0
X
 
 
25666
or34
509
301
85
0
X
 
 
25665
cMSD1
331
734
176
0
X
 
 
25664
NESG Target OR34
509
301
85
0
X
 
 
25663
Link HUMAN TSG-6
575
358
93
0
X
 
 
25662
or446
585
422
99
0
X
 
 
25661
rna-ligand complex
307
265
117
7
 
 
X
25660
Y48pCMF variant of human cytochrome c in its reduced state
649
423
95
0
X
 
 
25659
TDP-43 Amyloidogenic Core Region
137
144
46
0
X
 
 
25658
METAL-BINDING SITE OF THE MEMBRANE FUSION PROTEIN SILB
798
678
159
0
X
 
 
25657
Proteasome protein fragment
477
304
63
0
X
 
 
25656
Translation initiation factor IF-1 from Burkholderia thailandensis E264
312
281
71
0
X
 
 
25655
II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUM
511
394
51
0
 
 
X
25654
II-III-VI three-way junction from the VS ribozyme
511
394
51
0
 
 
X
25653
ASTEROPSIN G
176
107
0
0
X
 
 
25652
PTBRRM1-SL23H complex
869
535
119
0
X
 
X
25651
active G-quadruplex motif from AGRO100
247
0
0
0
 
X
 
25650
RNA recognition motif-1 of serine/arginine-rich protein 1
415
356
84
0
X
 
 
25649
Human Brd4 ET domain in complex with MLV Integrase C-term
449
354
86
0
X
 
 
25648
p75-TMDCD/LPN
177
121
32
0
X
 
 
25647
p75-TMDCD/DPC
338
245
61
0
X
 
 
25646
p75-TMICD/LPN
336
0
0
0
X
 
 
25645
HSPB1_ACD
189
176
81
0
X
 
 
25643
Amino-terminal domain of Latrodectus hesperus MaSp1 with neutralized acidic cluster
618
367
128
0
X
 
 
25642
cytoskeletal bactofilin BacA
97
418
102
0
X
 
 
25640
INTERACTION OF CYTOCHROME C AND CARDIOLIPIN
603
396
103
0
X
 
 
25639
LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)
502
345
81
0
X
 
 
25638
C-terminal domain of the chromodomain helicase DNA-binding protein 1
647
467
111
0
X
 
 
25636
AVR-Pia monomer
381
196
61
0
X
 
 
25634
ABD monomer
305
214
53
0
X
 
 
25632
TBD_1-22
236
135
46
0
X
 
 
25631
ace-pvhct-nh2
134
0
0
0
X
 
 
25630
nonspecific lipid transport protein from the dill Anethum graveolens L.
498
361
102
0
X
 
 
25629
Kinase
203
410
203
0
X
 
 
25628
Kinase
154
334
154
0
X
 
 
25627
meiosis-expressed gene 1 (Meig1)
553
410
99
0
X
 
 
25626
G88A,D90R double mutant of KaiB
66
208
66
0
X
 
 
25625
G89A,D91R double mutant of KaiB bound to CI
49
155
49
0
X
 
 
25624
G89A,D91R double mutant of KaiB
94
309
94
0
X
 
 
25623
G89A,D91R double mutant of dimeric KaiB
85
271
85
0
X
 
 
25622
D91R single mutant of dimeric KaiB (thioredoxin-like fold)
77
244
77
0
X
 
 
25621
D91R single mutant of dimeric KaiB
51
168
51
0
X
 
 
25620
G89A single mutant of dimeric KaiB
61
199
61
0
X
 
 
25619
N-SasA bound to CI
69
235
69
0
X
 
 
25618
N-SasA
79
175
79
0
X
 
 
25617
dimeric KaiB bound to CI
44
144
44
0
X
 
 
25616
KaiB dimer
89
281
89
0
X
 
 
25615
insulin analogue
289
0
0
0
X
 
 
25614
insulin analogue
240
77
0
0
X
 
 
25613
[B26-B29 triazole cross-linked]-insulin analogue
290
106
7
0
X
 
 
25612
OR358
426
306
70
0
X
 
 
25611
OR303
525
366
96
0
X
 
 
25610
pheromone Ep-1 from Euplotes petzi
145
0
0
0
X
 
 
25609
RsAFP2
309
142
51
0
X
 
 
25607
AR-25Q
528
431
154
0
X
 
 
25606
AR-4Q
457
375
133
0
X
 
 
25605
HsAFP1
307
99
39
0
X
 
 
25604
double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA
180
151
0
22
 
 
X
25603
murine tumour necrosis factor alpha CDE RNA
185
148
33
21
 
 
X
25602
GAT
87
263
87
0
X
 
 
25601
closed state of Lys63-linked diubiquitin
135
0
135
0
X
 
 
25600
LigA4 Big domain
385
247
105
0
X
 
 
25599
Sds3 in complex with Sin3A
819
631
154
0
X
 
 
25598
ASTEROPSIN F FROM MARINE SPONGE ASTEROPUS
184
96
0
0
X
 
 
25597
Dynorphin 1-13 bound to Kappa Opioid Receptor
109
18
18
0
X
 
 
25596
G-quadruplex
166
0
0
0
 
X
 
25595
TDP-43 prion-like hydrophobic helix in DPC
155
84
40
0
X
 
 
25593
HER2/ErbB2 dimeric transmembrane domain
318
219
54
0
X
 
 
25592
Vpu cytoplasmic domain
104
142
52
0
X
 
 
25591
Vpu from HIV-1
0
112
47
0
X
 
 
25590
Fag s 1
886
652
150
0
X
 
 
25588
High-affinity calmodulin complexes with vanilloid ligands of TRPV1
515
464
145
0
X
 
 
25587
Miz-1 zinc fingers 2 to 4
466
395
99
0
X
 
 
25586
wt NS4A N-terminal domain of DENV
41
92
41
0
X
 
 
25585
contryphan-Vc1
175
110
32
0
X
 
 
25584
complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)
794
578
144
0
X
 
 
25583
Complex between the Transactivation Domain of p65 and p62/Tfb1 subunit of TFIIH
856
641
152
0
X
 
 
25582
Protein and DNA complex
107
76
14
0
X
X
 
25577
human SUMO2
578
411
106
0
X
 
 
25576
human SUMO1
607
433
104
0
X
 
 
25575
SAP30L corepressor protein
426
247
64
0
X
 
 
25574
Antimicrobial Peptide SmAMP2-2c
152
81
0
0
X
 
 
25573
Myristylated Feline Immunodeficiency Virus Matrix Protein
454
321
120
0
X
 
 
25572
Dad2
50
115
49
0
X
 
 
25571
HIV-1 Core Packaging Signal
695
0
0
0
 
 
X
25570
ns5bc
170
102
24
0
X
 
 
25569
PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide
211
0
0
0
X
 
 
25568
VSTx1
220
154
39
0
X
 
 
25567
YP_193882.1
795
551
140
0
X
 
 
25566
PrxQ
69
189
69
0
X
 
 
25565
BCOR PUFD
559
447
103
0
X
 
 
25564
Third Type III Domain from Human Fibronectin
557
439
99
0
X
 
 
25562
PR domain from PRDM16
988
737
168
0
X
 
 
25561
ASC PYD
100
192
100
0
X
 
 
25560
MRH-GIIb
517
356
96
0
X
 
 
25559
C-terminal domain of human polymerase Rev1 in complex with PolD3 RIR-motif
585
338
103
0
X
 
 
25558
MAX1 peptide fibril
0
37
4
0
X
 
 
25557
PrxQ
151
504
151
0
X
 
 
25556
MRG15-MRGBP complex
1210
925
217
0
X
 
 
25555
PvHCt
140
0
0
0
X
 
 
25554
nucleotide-free Ran GTPase
1137
874
294
0
X
 
 
25553
SUMO1 and ZZ-domain from CBP
92
14
92
0
X
 
 
25552
PLK4-PB3 monomer
118
266
82
0
X
 
 
25551
Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome c
229
0
229
0
X
 
 
25549
mBMAL2-TAD
41
84
41
0
X
 
 
25548
DHX36
107
77
17
0
X
 
 
25546
MDMX-295
571
398
94
0
X
 
 
25545
MyUb (1080-1122) of human Myosin VI with K63-diUb
945
698
156
0
X
 
 
25544
human Myosin VI isoform3 (1050-1131)
527
366
89
0
X
 
 
25543
human Myosin VI isoform3 (998-1071)
449
294
82
0
X
 
 
25542
MyUb (1080-1131) of human Myosin VI
379
273
64
0
X
 
 
25541
MyUb (1080-1122) of human Myosin VI
316
232
55
0
X
 
 
25540
NSsCT-Tfb1PH complex
807
597
143
0
X
 
 
25539
EPI-X4, a human albumin-derived peptide
100
0
0
0
X
 
 
25538
Mdmx-SJ212
584
401
96
0
X
 
 
25537
Cn-AMP1
31
0
0
0
X
 
 
25536
MDMX-057
580
413
95
0
X
 
 
25535
alpha-synuclein fibrils
0
207
58
0
X
 
 
25534
26mer Box C/D RNA (5'-R(P*CP*UP*GP*AP*GP*CP*UP*CP*GP*AP*AP*AP*GP*AP*GP*CP*AP*AP*UP*GP*AP*UP*G)-3')
0
173
49
9
 
 
X
25533
Ca-bound hN-1 8-11
682
524
161
0
X
 
 
25532
Gag
326
1013
326
0
X
 
 
25531
N2-dG IQ at G1 in NarI sequence
156
0
0
0
 
X
 
25530
AQ1974
509
385
77
0
X
 
 
25529
hylin a1
85
0
0
0
X
 
 
25528
DNA Dodecamer with 8-oxoguanine at 4th Position
162
0
0
0
 
X
 
25527
alpha-crystallin domain from human, HSPB5
524
359
95
0
X
 
 
25526
RNA 27-MER, RIBOSTAMYCIN
205
180
27
8
 
 
X
25525
Neuromedin C in presence of SDS micelles
57
34
12
0
X
 
 
25524
Neuromedin C in 90% TFE
56
34
11
0
X
 
 
25523
Neuromedin C in 60% TFE
56
34
11
0
X
 
 
25522
Neuromedin C in 40% TFE
56
33
11
0
X
 
 
25521
Neuromedin C in 25% TFE
57
34
12
0
X
 
 
25520
Neuromedin C in 10% TFE
57
34
12
0
X
 
 
25519
Neuromedin C in water
57
34
12
0
X
 
 
25518
Alpha-Synuclein
0
135
39
0
X
 
 
25517
Short hydrophobic peptide, 11mer
20
0
0
0
X
 
 
25516
Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1
108
13
0
0
X
 
 
25515
non-phosphorylated J-domain of Human Cysteine String Protein (CSP)
555
410
104
0
X
 
 
25514
phosphorylated J-domain of Human Cysteine String Protein (CSP)
553
400
106
0
X
 
 
25513
TSPO A147T variant in complex with PK11195
955
588
171
0
X
 
 
25512
VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS
746
470
114
0
X
 
 
25511
cChimeraX-A162H, Ca2+ bound
91
0
91
0
X
 
 
25510
AIM2 PYD from Mus musculus
477
378
94
0
X
 
 
25509
APOBEC3G NTD variant, sNTD
289
317
147
0
X
 
 
25508
Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b
430
361
93
0
X
 
 
25505
CCR5-ECL2 helical structure, residues Q186-T195
20
30
10
0
X
 
 
25504
Staphylococcus aureus FusB:EF-GC3 complex
283
246
283
0
X
 
 
25502
Peptidyl-prolyl cis-trans isomerase A
977
445
173
0
X
 
 
25501
SH2-SH3 adapter protein drk
110
293
110
0
X
 
 
25500
SH2-SH3 adapter protein drk
97
297
97
0
X
 
 
25499
RRM3 domain of Hrb1
559
288
113
0
X
 
 
25498
RRM2 domain of Hrb1
527
409
102
0
X
 
 
25497
RRM1 domain of Hrb1
486
371
89
0
X
 
 
25496
RRM3 domain of Gbp2
569
369
112
0
X
 
 
25495
cNTnC-cTnIA162H
595
239
83
0
X
 
 
25494
First and Second KH domains of hnRNP E1
527
421
148
0
X
 
 
25493
Human Med26 N-Terminal Domain (1-92)
456
402
95
0
X
 
 
25492
HIRAN
615
466
116
0
X
 
 
25491
Conantokin Rl-B
106
73
17
0
X
 
 
25490
Conantokin Rl-B
97
74
18
0
X
 
 
25489
PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane
994
62
223
0
X
 
 
25488
PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane
994
62
223
0
X
 
 
25487
Purotoxin-2 in DPC micelles
369
176
62
0
X
 
 
25486
Purotoxin-2 in water
41
0
41
0
X
 
 
25485
PRO Form of Human Matrilysin (proMMP-7)
1274
1003
237
0
X
 
 
25484
p300 Taz2-p53 TAD2 Complex
627
442
99
0
X
 
 
25483
Metal Binding of Glutaredoxins
481
361
88
0
X
 
 
25482
GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)
1112
705
156
0
X
 
 
25481
perforin C2 quad mutant
108
211
108
0
X
 
 
25479
Rad6
76
0
76
0
X
 
 
25478
IL4pSER411
78
0
0
0
X
 
 
25477
oxidized triheme cytochrome PpcA
405
0
63
0
X
 
 
25476
His_ST-Crl
787
570
131
0
X
 
 
25475
Tau(267-312) bound to Microtubules
43
0
0
0
X
 
 
25474
Protegrin-3 (PG3)
110
56
14
0
X
 
 
25473
Pcf11
635
454
107
0
X
 
 
25472
mu-SLPTX-Ssm6a
205
0
0
0
X
 
 
25471
IL4pSER415
69
0
0
0
X
 
 
25470
IL4pSER402
74
0
0
0
X
 
 
25469
hnRNP C RRM in complex with 5'-UUUUC-3' RNA
651
428
117
0
X
 
X
25468
PDFL2.1
330
161
55
0
X
 
 
25467
GB1-PLAT (PKD1_PLAT)
109
325
109
0
X
 
 
25466
BCL-XL
150
295
150
0
X
 
 
25465
ConRlBNQO
91
67
19
0
X
 
 
25464
MbtH-like protein from Mycobacterium marinum
352
267
65
0
X
 
 
25463
NS1B ED dimer
136
376
135
0
X
 
 
25462
NS1B ED mutant monomer
136
408
136
0
X
 
 
25461
CUE domain of yeast Cue1
426
305
81
0
X
 
 
25460
Fungus protein B9WZW9_MAGOR
418
228
81
0
X
 
 
25459
Fungus protein Q8J180_MAGGR
423
238
86
0
X
 
 
25458
Odin-Sam1 fragment
267
0
0
0
X
 
 
25457
Cullin3 - BTB interface
119
0
0
0
X
 
 
25456
Cullin3 - BTB interface
120
0
0
0
X
 
 
25455
cytochrome OmcF
471
235
86
0
X
 
 
25454
bacterial chaperone
444
337
86
0
X
 
 
25453
Human galectin-8
659
537
129
0
X
 
 
25452
Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium Channels
223
114
0
0
X
 
 
25451
dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei
536
404
92
0
X
 
 
25449
RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum
449
366
97
0
X
 
 
25448
N-terminal domain of human TIG3
624
355
112
0
X
 
 
25447
KstB-PCP(apo)
479
273
92
0
X
 
 
25446
KstB-PCP (holo)
464
233
89
0
X
 
 
25445
A2A-ct
111
344
122
0
X
 
 
25443
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)
782
572
135
0
X
 
 
25442
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255
867
527
148
0
X
 
 
25441
VP8
142
466
142
0
X
 
 
25440
Bud31p protein
27
0
0
0
X
 
 
25439
Bud31p protein
878
509
167
0
X
 
 
25437
Endo T5-ZN+2
792
475
135
0
X
 
 
25436
hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA
664
464
117
0
X
 
X
25435
Amylase binding Protein A
825
640
177
0
X
 
 
25434
OCRE
505
294
93
0
X
 
 
25433
RBM10_ZnF1
210
140
39
0
X
 
 
25432
TOG
1499
1120
253
0
X
 
 
25430
GADD34 PP1 complex
226
203
63
0
X
 
 
25429
42-Residue Beta Amyloid Fibril
0
78
25
0
X
 
 
25428
acidic domain of SYNCRIP (hnRNPQ)
491
339
92
0
X
 
 
25425
transforming growth factor beta induced protein (TGFBIp)
148
540
148
0
X
 
 
25424
DEFA1, a highly potent antimicrobial peptide from the horse
138
0
0
0
X
 
 
25423
NDP52 ubiquitin-binding zinc finger
211
103
34
0
X
 
 
25422
human Cyt c G41S mutant (ferric)
91
277
91
0
X
 
 
25421
G7W/N24S Hhn2b
202
145
35
0
X
 
 
25420
human Cyt c G41S mutant (ferrous)
94
194
94
0
X
 
 
25419
TRTX-Tp1a from the tarantula Thrixopelma pruriens
207
0
0
0
X
 
 
25418
human Cyt c
101
193
99
0
X
 
 
25417
CadC1-159
617
482
156
0
X
 
 
25416
RNA (39-MER), 3' splice site in influenza A: 39-nt hairpin
166
0
0
0
 
 
X
25415
3' splice site influenza A: 19-nt duplex
140
0
0
14
 
 
X
25414
3' splice site influenza A: 11-nt hairpin
97
0
0
10
 
 
X
25413
hVDAC1
0
250
77
0
X
 
 
25411
MPMV MA T41I T78I
577
374
100
0
X
 
 
25410
Sigma-1 receptor delta 35 construct
168
429
169
0
X
 
 
25409
VG16KRKP, an antimicrobial peptide in SDS
83
0
0
0
X
 
 
25408
VG16KRKP, an antimicrobial peptide in D8PG micelles
83
0
0
0
X
 
 
25407
DNA complex of the C-Terminal domain of MvaT
492
163
51
0
X
X
 
25406
H56P
76
0
76
0
X
 
 
25405
C-terminal domain of MvaT
287
207
50
0
X
 
 
25404
VPg of porcine sapovirus
379
277
67
0
X
 
 
25403
Clathrin Heavy Chain
269
869
268
0
X
 
 
25402
SNX3FL
1001
729
165
0
X
 
 
25401
CCL28
604
434
110
0
X
 
 
25400
lcFABP
713
512
136
0
X
 
 
25399
Medin
66
144
48
0
X
 
 
25398
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 5.5
718
469
145
0
X
 
 
25397
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 7.2
695
504
140
0
X
 
 
25396
mouse EpoR
183
136
45
0
X
 
 
25395
internal EH domain of gamma-synergin
626
382
86
0
X
 
 
25394
complex of Dvl PDZ domain with ligand
39
24
0
0
X
 
 
25393
IST1 peptide
56
184
56
0
X
 
 
25391
tumor protein monomer
929
709
165
0
X
 
 
25390
holo-axxa_cytc
75
0
75
0
X
 
 
25389
holo-wt-cytc
75
0
75
0
X
 
 
25387
bpsl1445
849
663
168
0
X
 
 
25386
zinc finger domain
356
267
78
0
X
 
 
25385
Ssa1 substrate binding domain
909
727
176
0
X
 
 
25384
BecN-150CSY monomer
293
438
142
0
X
 
 
25383
human TRAP1-NTD
158
472
158
0
X
 
 
25382
UBX-L domain of VCIP135
552
316
79
0
X
 
 
25381
E. coli threonylcarbamoyl-AMP synthase TsaC
874
723
168
0
X
 
 
25380
HP0268 from Helicobacter pylori
403
328
80
0
X
 
 
25379
PsbP
1084
749
194
0
X
 
 
25378
A G-quadruplex structure
232
0
0
0
 
X
 
25377
MDMX-P53
447
0
0
0
X
 
 
25376
RING Domain of human Promyelocytic Leukemia Protein (PML)
319
173
57
0
X
 
 
25375
PTP1B CPT-157633 Complex
212
244
212
0
X
 
 
25372
CG KIX
481
338
82
0
X
 
 
25370
Crotalicidin-Ct
152
82
0
0
X
 
 
25369
DNA Dodecamer with 8-oxoguanine at 10th Position
160
0
0
0
 
X
 
25367
YMRRA
160
445
160
0
X
 
 
25366
crotalicidin-Nt
111
52
0
0
X
 
 
25365
SLBP
37
92
37
0
X
 
 
25364
SLBP/RNA
62
148
62
0
X
 
X
25363
crotalicidin in DPC micelles
263
105
0
0
X
 
 
25362
Y171W mutant of Adenylate Kinase in complex with Ap5a for state b
61
0
61
0
X
 
 
25361
Y171W mutant of Adenylate Kinase in complex with Ap5a for state a
194
0
194
0
X
 
 
25360
P177A mutant of Adenylate Kinase in complex with Ap5a
181
0
181
0
X
 
 
25359
BamA
20
41
20
0
X
 
 
25358
periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor
993
741
180
0
X
 
 
25357
Adenylate Kinase Y171W
200
0
200
0
X
 
 
25356
TPMT *1 16-245
157
488
157
0
X
 
 
25355
EphB2 kinase domain
240
799
240
0
X
 
 
25354
Abp1p SH3 domain
265
215
57
0
X
 
 
25353
Kinase
198
0
198
0
X
 
 
25352
Acidocin B
279
0
0
0
X
 
 
25350
PsbQ from spinacia oleracea
770
638
148
0
X
 
 
25349
WW3
265
184
44
0
X
 
 
25348
53BP1 tandem Tudor domains in complex with a p53K382me2 peptide
801
584
115
0
X
 
 
25347
53BP1 tandem Tudor domains in complex with a p53K370me2 peptide
804
585
116
0
X
 
 
25346
MG200 EAGRbox
220
317
79
0
X
 
 
25345
PfCDPK3 CLD(B)
84
245
84
0
X
 
 
25344
CaM Tr2C, monomer
397
305
71
0
X
 
 
25343
Talin-F3 / RIAM N-terminal Peptide complex
603
0
90
0
X
 
 
25342
NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN
866
607
161
0
X
 
 
25341
CypC
180
351
180
0
X
 
 
25340
CypD+peptide
150
291
150
0
X
 
 
25339
CypC+peptide
175
0
175
0
X
 
 
25338
CypB+peptide
164
310
164
0
X
 
 
25337
CypA+peptide
157
298
157
0
X
 
 
25336
GeoCyp+peptide
132
265
132
0
X
 
 
25335
VG16KRKP, an antimicrobial peptide in LPS
90
0
0
0
X
 
 
25334
Type 1 Pilus
0
639
161
0
X
 
 
25333
hL-FABP:TCH
130
250
130
0
X
 
 
25332
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1, Ser3, and Ser14
196
0
0
0
X
 
 
25331
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1 and Ser3
194
0
0
0
X
 
 
25330
HUAB
168
501
168
0
X
 
 
25329
HUB2
85
252
85
0
X
 
 
25328
HUA2
86
254
86
0
X
 
 
25327
Bd0108
249
271
69
0
X
 
 
25326
carboxy-terminal domain of DNTTIP1
618
382
108
0
X
 
 
25325
Protein Hybrid Beta-Synuclien HC
133
260
133
0
X
 
 
25324
ligand-free OAA
717
511
157
0
X
 
 
25315
FBP28 WW2 mutant Y438R DN
184
0
0
0
X
 
 
25314
FBP28 WW2 mutant Y438R L453A DNDC
154
0
0
0
X
 
 
25313
FBP28 WW2 mutant Y438R DNDC
157
0
0
0
X
 
 
25312
MBD1 CXXC1
294
0
62
0
X
 
 
25311
FBP28 WW2 mutant W457F
192
0
0
0
X
 
 
25310
FBP28 WW2 mutant Y446L
196
0
0
0
X
 
 
25309
FBP28 WW2 , mutation Y438R
194
0
0
0
X
 
 
25308
obscurin Ig58
493
376
91
0
X
 
 
25307
SATB1 homeodomain
82
0
73
0
X
 
 
25306
OAA monomer
717
511
157
0
X
 
 
25305
titin M10
83
238
83
0
X
 
 
25304
obscurin Ig1 bound to titin M10
76
0
76
0
X
 
 
25303
titin M10-obscurin-Ig1
79
0
79
0
X
 
 
25302
Monomer of Mo3964
200
144
37
0
X
 
 
25301
OBSC-Ig1
78
263
78
0
X
 
 
25300
bee venom toxin melittin with [(C5H5)Ru]+ fragment attached to the tryptophan residue
136
22
0
0
X
 
 
25299
Human Small Ubiquitin like Modifier protein-1 (SUMO-1)
396
383
94
0
X
 
 
25298
Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein
297
218
46
0
X
 
 
25297
lasso peptide streptomonomicin
122
21
0
0
X
 
 
25296
Hha-H-NS46 charge zipper complex
120
0
115
0
X
 
 
25294
NP_809137.1 monomer
668
384
124
0
X
 
 
25293
Kalata B7 Ser mutant
152
70
22
0
X
 
 
25292
RT216
131
284
131
0
X
 
 
25291
RNA duplex
77
48
0
8
 
 
X
25290
ASR trimer
0
167
82
0
X
 
 
25289
amyloid-beta fibrils: the Osaka mutation
0
178
48
0
X
 
 
25288
TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)
610
362
108
0
X
 
 
25287
5-phenyl-3-oxo-pentyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor
484
355
90
0
X
 
 
25284
3,7-dioxo-octyl Actinorhodin Acyl Carrier Protein
455
339
86
0
X
 
 
25283
scoloptoxin SSD609 from Scolopendra mutilans
217
0
0
0
X
 
 
25282
MJ0366
176
269
92
0
X
 
 
25281
YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS)
146
280
146
0
X
 
 
25280
mouse BMAL1 transactivation domain
257
200
49
0
X
 
 
25278
RisS
75
247
77
0
X
 
 
25277
lantibiotic self-resistance lipoprotein MlbQ from Microbispora ATCC PTA-5024
461
347
82
0
X
 
 
25276
eEF1Bdelta CAR domain in TCTP-bound state
228
159
44
0
X
 
 
25275
eEF1Bdelta CAR domain
244
173
44
0
X
 
 
25274
cytosolic part of Trop2
168
74
21
0
X
 
 
25273
phosphorylated cytosolic part of Trop2
131
0
0
0
X
 
 
25270
SpoVM P9A mutant
142
97
24
0
X
 
 
25269
ASM1
252
152
45
0
X
 
 
25268
SpoVM
140
89
22
0
X
 
 
25267
TRIM25 (PRYSPRY) domain
183
544
183
0
X
 
 
25266
decorin binding protein B
788
711
173
0
X
 
 
25265
Uncharacterized protein
502
365
86
0
X
 
 
25264
60S pre-ribosome
89
176
89
0
X
 
 
25263
CUS-3id
612
461
119
0
X
 
 
25261
[GlnB22]-insulin mutant
288
0
0
0
X
 
 
25260
human insulin
297
131
40
0
X
 
 
25259
hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4
962
565
175
0
X
 
 
25257
Y99E CAM-eNOS
141
0
141
0
X
 
 
25254
toxin, RhTx
143
0
0
0
X
 
 
25253
Y99E,N111D CAM-iNOS
656
0
144
0
X
 
 
25251
PrPdelta193-196
674
138
146
0
X
 
 
25250
PrPdelta190-197
778
569
141
0
X
 
 
25249
RING Finger monomer
193
165
63
0
X
 
 
25248
RING Finger monomer
198
165
64
0
X
 
 
25244
HuR_RRM1 monomer
554
412
106
0
X
 
 
25243
Arsenate Reductase
723
542
138
0
X
 
 
25242
Sk45mNoTag
1204
488
225
0
X
 
 
25241
N-domain of the AAA metalloproteinase Yme1
426
318
56
0
X
 
 
25240
Twinstar from Drosophila melanogastor
874
652
146
0
X
 
 
25239
La-RRM1
938
706
162
0
X
 
 
25238
Human Relaxin-2
273
87
0
0
X
 
 
25237
MBP
464
1137
340
0
X
 
 
25236
rocker tetramer
0
0
0
0
X
 
 
25235
FtsH periplasmic N-domain
19
12
3
0
X
 
 
25234
M2 19-49
0
7
0
0
X
 
 
25233
S31N 19-49
0
7
0
0
X
 
 
25232
F231L mutant ERCC1-XPF dimerization region
971
695
172
0
X
 
 
25231
14-3-3 Zeta
190
377
189
0
X
 
 
25230
Human FAAP20 UBZ-Ubiquitin Complex
710
522
122
0
X
 
 
25229
Human FAAP20 UBZ
233
142
40
0
X
 
 
25228
aSyn H50Q monomer
275
399
131
0
X
 
 
25227
aSyn WT monomer
269
388
131
0
X
 
 
25226
cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
447
247
82
0
X
 
 
25225
trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
441
239
81
0
X
 
 
25224
human IgG-Fc
197
542
198
0
X
 
 
25223
mu-SLPTX3-Ssm6a
270
188
49
0
X
 
 
25222
Phospholamban
49
0
49
0
X
 
 
25221
PHD domain of Yeast YNG2
310
213
49
0
X
 
 
25220
RNA duplex
83
28
0
9
 
 
X
25219
UBM1 domain of human HUWE1/ARF-BP1
271
195
45
0
X
 
 
25218
amyloid beta
192
78
42
0
X
 
 
25217
AUX IAA17
520
428
108
0
X
 
 
25215
SERA protein peptide analogue 6737
131
0
0
0
X
 
 
25214
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
420
225
66
0
X
 
 
25213
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
304
175
48
0
X
 
 
25212
protegrin-2 docked to DPC Micelles
95
0
0
0
X
 
 
25211
peptide 6762
136
0
0
0
X
 
 
25210
PUTATIVE MEMBRANE PROTEIN IGAA HOMOLOG
705
524
111
0
X
 
 
25209
synthetic peptide 36075
129
0
0
0
X
 
 
25208
S100A4dC-MPT complex
174
526
178
0
X
 
 
25207
1585 Malarial Peptide
140
0
0
0
X
 
 
25206
high-activity binding peptide 6505
95
0
0
0
X
 
 
25205
analgesic sea anemone peptide APETx2
228
0
0
0
X
 
 
25204
Malarial Peptide 6673
137
0
0
0
X
 
 
25203
Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparum
128
0
0
0
X
 
 
25202
PEPTIDE BELONGING THE N-TERMINAL REGION DERIVED OF MEROZOITE SURFACE PROTEIN-2 OF PLASMODIUM FALCIPARUM
124
0
0
0
X
 
 
25201
1513 MSP-1 peptide
109
0
0
0
X
 
 
25200
STARP peptide 20570
129
0
0
0
X
 
 
25199
myrGCAP2
167
356
167
0
X
 
 
25197
wrapping silk W2
374
786
374
0
X
 
 
25196
haloSRC
81
217
81
0
X
 
 
25195
putative arsenate reductase from Brucella melitensis
639
524
115
0
X
 
 
25194
NisI
710
537
138
0
X
 
 
25193
NisI
217
641
217
0
X
 
 
25192
L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide
96
96
96
0
X
 
 
25191
STARP peptide 20546
126
0
0
0
X
 
 
25190
malaria short AMA-1 peptide analogue
118
0
0
0
X
 
 
25189
malaria peptide 1815
113
0
0
0
X
 
 
25188
YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA
966
683
155
0
X
 
X
25187
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA
72
32
11
0
X
 
 
25186
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA
73
41
11
0
X
 
 
25185
FG-N-6His
120
352
120
0
X
 
 
25184
FG-N
78
256
78
0
X
 
 
25183
FSFG-K-6His
113
361
113
0
X
 
 
25182
FSFG-K
109
350
109
0
X
 
 
25181
Hepatitis C Virus p7
58
61
58
0
X
 
 
25180
mutNS4A
145
137
46
0
X
 
 
25179
wtNS4A
154
137
46
0
X
 
 
25178
p7 protein of hepatitis C virus
0
86
47
0
X
 
 
25177
De Novo Designed Peptide that Sequesters Toxic Heavy Metals
393
298
69
0
X
 
 
25176
Filamin repeat 21 bound to integrin
784
400
133
0
X
 
 
25175
NisI
669
493
117
0
X
 
 
25174
Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA
72
37
11
0
X
 
 
25173
N-terminal dopmain of NikR
48
143
49
0
X
 
 
25172
Ca-bound hN-1 4-7
668
489
146
0
X
 
 
25171
MLL-IBD complex
588
533
148
0
X
 
 
25169
Stable Peptide Biomarker RCB-1
108
38
15
0
X
 
 
25168
flpp3Sol 2
534
421
112
0
X
 
 
25167
Human Shq1 CS domain
86
261
86
0
X
 
 
25166
ectodomain of the B. subtilis RodZ
651
480
110
0
X
 
 
25165
OR109
511
377
92
0
X
 
 
25164
three-way junction from the VS ribozyme
368
286
39
0
 
 
X
25163
three-way junction from the VS ribozyme
368
286
39
0
 
 
X
25162
CrnA2'
140
0
0
0
X
 
 
25161
CrnA1'
180
0
0
0
X
 
 
25160
RRM1 of human LARP6
559
461
104
0
X
 
 
25159
LARP6-LaM
545
416
98
0
X
 
 
25158
Doc48S monomer
398
299
78
0
X
 
 
25157
Decorin Binding Protein A
781
682
155
0
X
 
 
25156
Decorin Binding Protein A
517
427
156
0
X
 
 
25155
apo FldB
785
623
160
0
X
 
 
25154
DMXAA-bound mSTING dimer
234
663
221
0
X
 
 
25153
holo FldB
963
750
185
0
X
 
 
25152
MTAbl13, a grafted MCoTI-II
211
0
0
0
X
 
 
25151
Hs1a
208
111
39
0
X
 
 
25150
human ubiquitin conjugating enzyme Ube2w
224
367
113
0
X
 
 
25149
Isolated Ring domain
421
292
76
0
X
 
 
25148
NTD-NUSA
710
530
121
0
X
 
 
25147
DNA binding domain of sigma 54 from E.coli
408
281
71
0
X
 
 
25146
httNTQ30P10K2 fibrils
0
69
6
0
X
 
 
25142
Hox homeodomain
363
285
71
0
X
 
 
25141
EL_LovR
70
232
70
0
X
 
 
25140
apo EL_LovR
304
186
68
0
X
 
 
25139
MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1
554
381
105
0
X
 
 
25138
DRB4(1-153)
797
559
148
0
X
 
 
25137
EL_LovR
705
530
121
0
X
 
 
25136
S100A4dC
87
298
87
0
X
 
 
25135
MLKL N-terminal domain
967
690
169
0
X
 
 
25132
VEEV macro domain
806
629
147
0
X
 
 
25131
Kindlin-2 F2
88
0
0
0
X
 
 
25130
LEDGF/p75 IBD in complex with MLL1 peptide (140-160)
614
372
89
0
X
 
 
25129
P-superfamily conotoxin Bru9a cyclised with a Gly-Leu-Pro linker
129
0
0
0
X
 
 
25128
P-superfamily conotoxin Gm9a cycled with a Gly-Leu-Pro linker
146
0
0
0
X
 
 
25127
putative phosphoglycolate phosphatase
1035
696
230
0
X
 
 
25125
Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C
713
542
124
0
X
 
 
25124
BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C
712
549
126
0
X
 
 
25123
microcrystallized Ubiquitin in MPD
0
337
71
0
X
 
 
25122
SCORPION VENOM TOXIN Ts11 (TsPep1) FROM Tity
150
72
0
0
X
 
 
25120
cTnC-cTnI[1-73]-cTnI[144-163]
758
615
162
0
X
 
 
25119
cTnI[1-73]-cTnC
369
282
67
0
X
 
 
25118
cTnI[1-73]
264
227
66
0
X
 
 
25116
GTPase KRas-GNP:ARafRBD complex
13
13
0
0
X
 
 
25115
K-Ras and membrane scaffold protein
11
11
0
0
X
 
 
25114
GTPase KRas-GDP tethered to a lipid-bilayer nanodisc
11
11
0
0
X
 
 
25112
circumsporozoite protein peptide
81
0
0
0
X
 
 
25110
left-handed G-quadruplex
267
0
0
0
 
X
 
25109
MAVS CARD
600
428
116
0
X
 
 
25108
PfI2
95
300
93
0
X
 
 
25107
DNA-quercetin
61
0
0
0
 
X
 
25106
CAG RNA
33
0
0
0
 
 
X
25104
CYCLOPHILIN A COMPLEXED WITH A FRAGMENT OF CRK-II
874
670
167
0
X
 
 
25102
rubredoxin domain of the NO Reductase Flavorubredoxin
322
0
54
0
X
 
 
25101
tRNApro:MLV Nucleocapsid Protein (1:1) Complex
222
33
0
0
X
 
X
25100
pf tRNApro:MLV-Nucleocapsid (1:2) Complex
219
33
0
0
X
 
X
25099
Hs2 dimer
100
0
0
0
 
X
 
25098
copper binding protein in the apo form
495
269
84
0
X
 
 
25096
MciZ from Bacillus subtilis
227
0
0
0
X
 
 
25094
EcMazE homodimer
81
0
78
0
X
 
 
25093
EcMazE homodimer
411
323
79
0
X
 
 
25092
MazE-DNA binding
65
0
61
0
X
X
 
25088
Ddi1UBL
465
331
84
0
X
 
 
25087
MPMV MA Y28F Y67F
789
575
141
0
X
 
 
25086
truncated EcMazE
362
269
65
0
X
 
 
25085
rhodanese domain of YgaP
580
415
102
0
X
 
 
25083
Putative uncharacterized protein BTH I2711
372
321
76
0
X
 
 
25082
Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide
53
0
0
0
X
 
 
25081
Fyn SH2 bound
668
497
115
0
X
 
 
25080
[FeZn]IMP-1
156
162
156
0
X
 
 
25079
human EpoR
131
90
42
0
X
 
 
25078
CSD1-SXL-18-mer msl2 mRNA
64
91
62
0
X
 
 
25077
PTPN4 PDZ-linker
116
367
116
0
X
 
 
25076
MAVS CARD filament
0
466
105
0
X
 
 
25072
SXL-UNR-msl2-mRNA
152
130
152
0
X
 
X
25071
Rad18-UBZ
142
102
27
0
X
 
 
25070
Rad18-UBZ/ubiquitin complex
602
438
106
0
X
 
 
25069
human Ca2+-loaded S100A4 cys-free mutant
556
400
103
0
X
 
 
25068
High mobility group protein from Plasmodium falciparum 3D7
419
351
80
0
X
 
 
25067
NESG Target OR459
660
486
104
0
X
 
 
25066
UBA domain of DNA-damage-inducible 1 protein (Ddi1)
246
0
45
0
X
 
 
25065
PCP7T holo form
480
196
74
0
X
 
 
25064
PCP7T
367
156
70
0
X
 
 
25063
[ZnZn]-IMP-1
196
555
196
0
X
 
 
25062
OR462
823
602
136
0
X
 
 
25061
Structure of De novo designed Protein OR457
780
583
120
0
X
 
 
25060
dCDS1-RNA
199
179
70
0
X
 
X
25059
dCSD1
355
270
72
0
X
 
 
25052
Nucleocapsid protein p10 and RNA (68-MER)
238
0
0
0
X
 
X
25050
membrane-active toxin from crab spider Heriaeus melloteei
206
88
0
0
X
 
 
25049
RNA (68-MER)
185
148
27
0
 
 
X
25048
Transient Collagen Triple Helix Binding to a Key Metalloproteinase
205
502
167
0
X
 
 
25047
RRM-PEPTIDE and RES COMPLEX
747
427
132
0
X
 
 
25046
DC-SIGNR CRD apo
84
0
84
0
X
 
 
25043
Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNA
1276
700
223
0
X
 
X
25042
Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNA
738
419
134
0
X
 
X
25041
First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNA
613
363
102
0
X
 
X
25040
most two C-terminal RNA Recognition Motif Domain of hnRNP L
1083
587
216
0
X
 
 
25039
Second RNA Recognition Motif Domain of hnRNP L
662
366
129
0
X
 
 
25038
hnRNP L
555
318
103
0
X
 
 
25037
N terminal domain of the MuB AAA+ ATPase
382
183
68
0
X
 
 
25036
CsUbl
378
244
80
0
X
 
 
25035
cChimeraX Ca2+ bound
101
188
101
0
X
 
 
25034
cChimera Ca2+ bound
171
0
95
0
X
 
 
25033
Chlamydomonas reinhardtii NAB1 cold shock domain, CSD1
364
265
71
0
X
 
 
25032
bacterial immunoglobulin-like domain form a surface protein of Leptospira
411
193
108
0
X
 
 
25031
spider-venom peptides against the analgesics target NaV1
197
140
35
0
X
 
 
25030
OMPA C-terminal domain
127
0
127
0
X
 
 
25029
hGH
148
455
148
0
X
 
 
25028
NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri
709
419
125
0
X
 
 
25027
NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482
560
324
107
0
X
 
 
25026
NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50
860
484
164
0
X
 
 
25024
RP domain of MiSp
257
136
112
0
X
 
 
25023
Drosophila ELF domain from FANCL
81
0
74
0
X
 
 
25022
Polyglutamine binding peptide 1 (QBP1)
69
44
11
0
X
 
 
25021
ROQ domain
148
439
148
0
X
 
 
25020
E55Q mutant of eRF1 N-domain
788
444
146
0
X
 
 
25019
DHFR-folate
140
295
140
0
X
 
 
25018
OR414
638
475
107
0
X
 
 
25016
Y125F mutant of eRF1 N-domain
793
441
146
0
X
 
 
25012
Cysteine Deleted Protegrin-1 (CDP-1): lr10
46
0
0
0
X
 
 
25011
Cysteine Deleted Protegrin-1 (CDP-1): rr11
49
0
0
0
X
 
 
25010
Hypertrophic Cardiomyopathy-Related R502W Mutant
556
326
100
0
X
 
 
25009
Cysteine Deleted Protegrin-1 (CDP-1): rr14
57
0
0
0
X
 
 
25008
Phosphotyrosine binding domain
458
63
89
0
X
 
 
25007
C3 DOMAIN OF CARDIAC MYOSIN BINDING PROTEIN-C, WT
560
423
99
0
X
 
 
25005
CAP-GLY DOMAIN
0
243
69
0
X
 
 
25004
D23N_parallel
0
59
0
0
X
 
 
25002
LysM region of the E. coli Intimin periplasmic domain
456
315
82
0
X
 
 
25001
aggregative adherence fimbriae
747
595
134
0
X
 
 
25000
WW3 domain of Nedd4L in complex with its HECT domain PY motif
219
59
27
0
X
 
 
21079
Influenza Hemagglutinin Peptide
78
51
0
0
X
 
 
21078
BLACD
115
0
0
0
X
 
 
21077
BLACC
120
0
0
0
X
 
 
21076
BLACB
115
0
0
0
X
 
 
21075
BLACA
124
0
0
0
X
 
 
21074
B3MP
118
0
0
0
X
 
 
21062
conotoxin Im10A
50
0
0
0
X
 
 
21057
SFTI-TCTR N12 N14
77
0
0
0
X
 
 
21056
SFTI-TCTR N12 N14 NMeSer6
79
0
0
0
X
 
 
21047
AIP-IV peptide
48
0
0
0
X
 
 
21046
AIP-II peptide
43
0
0
0
X
 
 
21045
AIP-I
44
0
0
0
X
 
 
21042
tAIP-III_D2A
32
0
0
0
X
 
 
21041
tAIP-III
33
0
0
0
X
 
 
21040
AIP-III_L7A peptide
38
0
0
0
X
 
 
21039
AIP-III_F5A_peptide
35
0
0
0
X
 
 
21038
AIP-III_DL7 peptide
45
0
0
0
X
 
 
21037
AIP-III_DF5
40
0
0
0
X
 
 
21036
AIP-III_D4A peptide
41
0
0
0
X
 
 
21035
AIP-III
37
0
0
0
X
 
 
21034
Lewisx methyl glycoside
29
21
0
0
 
 
 
21033
Lewisx-FimH
28
20
0
0
X
 
 
21032
SUGAR (3-MER)
40
27
0
0
 
 
 
21031
Lewis a
29
20
0
0
 
 
 
21028
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21027
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21026
MDCSGCSRPG + Zn basic
47
0
0
0
X
 
 
21025
MDCSGCSRPG + Zn acidic
48
0
0
0
X
 
 
21024
MDCSGCSRPG bound to Cu
48
0
0
0
X
 
 
21023
MDCSGCSRPG
48
0
0
0
X
 
 
21022
MDCSGCSRPG
48
0
0
0
X
 
 
21019
Chikungunya Virus Fusion Peptide
61
0
0
0
X
 
 
21018
Compstatin_10
88
0
0
0
X
 
 
21015
conotoxin pu14a
108
0
0
0
X
 
 
21014
conotoxin lt14a
69
0
0
0
X
 
 
21013
RI23
112
0
0
0
X
 
 
21010
extended upain
111
48
0
0
X
 
 
21009
upain-1
76
37
0
0
X
 
 
21008
TemporinL
82
0
0
0
X
 
 
21007
alpha-conotoxin ImI Cystathionine 1-3
64
0
0
0
X
 
 
21006
alpha-conotoxin ImI Cystathionine 2-4
63
0
0
0
X
 
 
21002
Tryptophan Zipper analogue
81
0
0
0
X
 
 
21001
neurotensin
97
0
0
0
X
 
 
21000
MccJ25 RGD
98
0
0
0
X
 
 
20128
conotoxin qc16a
45
0
0
0
X
 
 
20127
nociceptin Agonist
68
0
0
0
X
 
 
20126
Alpha-conotoxin Vc1.2
84
41
17
0
X
 
 
20125
VK22 in DPC micelles
96
0
0
0
X
 
 
20124
[113-122]ApoJ
69
0
0
0
X
 
 
20123
NS4A(1-22)
100
58
0
0
X
 
 
20122
CCAP-vil
57
0
0
0
X
 
 
20121
tubulysin
52
0
0
0
X
 
 
20119
thromboxane A2 receptor
121
0
0
0
X
 
 
20118
C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor
70
0
0
0
X
 
 
20117
Substance P in DMPC/CHAPS/GM1 bicelles
82
0
0
0
X
 
 
20116
Substance P in DMPC/CHAPS bicelles
82
0
0
0
X
 
 
20115
Substance P
82
0
0
0
X
 
 
20114
alpha-conotoxin FI
81
0
0
0
X
 
 
20113
Temporin-SHf
55
29
0
0
X
 
 
20112
Gaq-ct only
82
0
0
0
X
 
 
20111
SecA fragment
106
0
0
0
X
 
 
20110
VPgpU
140
0
1
0
X
 
 
20109
15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)
78
0
0
0
X
 
 
20108
SecA fragment
114
0
0
0
X
 
 
20107
conotoxin ImI analogue
62
0
0
0
X
 
 
20105
BI
96
0
0
0
X
 
 
20104
xt-7
84
0
0
0
X
 
 
20103
[Lysine4]XT-7
96
0
0
0
X
 
 
20102
t11
109
0
0
0
X
 
 
20101
Substance P
68
0
0
0
X
 
 
20098
Pis-1 [PG]
126
0
0
0
X
 
 
20095
cis Pis-1[NkG]
127
0
0
0
X
 
 
20094
trans Pis-1[NkG]
127
0
0
0
X
 
 
20093
REV analogue
120
0
0
0
X
 
 
20092
csp
81
0
0
0
X
 
 
20091
rsv analogue
76
0
0
0
X
 
 
20090
KAAAD
23
0
0
0
X
 
 
20089
nociceptin analogue
121
0
0
0
X
 
 
20088
nociceptin analogue
121
0
0
0
X
 
 
20087
nociceptin analogue
121
0
0
0
X
 
 
20086
nociceptin Antagonist
80
0
0
0
X
 
 
20085
SFT-L1
60
0
0
0
X
 
 
20084
Dirhodium complex
80
44
0
0
X
 
 
20082
Apelin-17
138
64
13
0
X
 
 
20081
complex BK-PGG
57
0
0
0
X
 
 
20080
hCGA(G364S)
120
0
0
0
X
 
 
20079
rhodopsin-jue11-complex
60
0
0
0
X
 
 
20078
HEDISTIN
124
0
0
0
X
 
 
20076
TC6b
122
0
0
0
X
 
 
20075
MeuTXKbeta1
145
0
0
0
X
 
 
20074
octamer
0
120
24
0
X
 
 
20073
cyclo[Trp-D-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20072
cyclo[Trp-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]
30
0
0
0
X
 
 
20071
cyclo[Trp-Ile-1,4-sub-(1,2,3)-triazole-D-Ala-Aod]
15
0
0
0
X
 
 
20070
Cyclic Tetrapeptide 1
41
0
0
0
X
 
 
20069
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20068
Cyclic Tetrapeptide 1
44
0
0
0
X
 
 
20067
Cyclic Tetrapeptide 1
42
0
0
0
X
 
 
20066
Cyclic Tetrapeptide 1
36
0
0
0
X
 
 
20065
Cyclic Tetrapeptide 1
35
0
0
0
X
 
 
20064
Cyclic Tetrapeptide 1
24
0
0
0
X
 
 
20063
Model Peptide
68
0
0
0
X
 
 
20062
Myelin Basic Protein
109
0
0
0
X
 
 
20061
GG8WF
47
0
0
0
X
 
 
20060
YI12FF
68
0
0
0
X
 
 
20059
YI12WY
72
0
0
0
X
 
 
20058
YI12WW
73
0
0
0
X
 
 
20057
YI12WF
69
0
0
0
X
 
 
20056
LSEAL-CaMLD complex
27
0
0
0
X
 
 
20055
KIA7H tetramer
105
22
0
0
X
 
 
20054
KIA7W tetramer
114
48
0
0
X
 
 
20053
Insulin A-chain variant peptide
101
46
0
0
X
 
 
20052
Human Insulin A-chain peptide
82
30
0
0
X
 
 
20051
Human Obestatin
117
0
0
0
X
 
 
20050
D-PAKKR monomer
39
0
0
0
X
 
 
20049
Mu-KIIIA[C1A,C9A]
88
15
12
0
X
 
 
20048
Mu-contoxin KIIIA
91
14
15
0
X
 
 
20047
fusionpeptide
67
0
0
0
X
 
 
20046
RAT IAPP-1-19
84
0
0
0
X
 
 
20045
HUMAN IAPP-1-19
82
0
0
0
X
 
 
20044
Interleukin-8 C-terminal domain
134
0
4
0
X
 
 
20043
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20042
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20041
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20040
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20039
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20038
Cyclic Pseudotetrapeptide
28
0
0
0
X
 
 
20037
Cyclic Pseudotetrapeptide
29
0
0
0
X
 
 
20036
Cyclic Pseudotetrapeptide
27
0
0
0
X
 
 
20034
4F
127
0
0
0
X
 
 
20033
dicarba-ImI
65
34
10
0
X
 
 
20032
GBAP
60
0
10
0
X
 
 
20031
Apelin 17
137
60
0
0
X
 
 
20030
Apelin 17
137
61
0
0
X
 
 
20029
Apelin 17
125
70
0
0
X
 
 
20028
Statherin
88
0
0
0
X
 
 
20027
brome mosaic virus protein 1a
86
57
17
0
X
 
 
20026
F protein
109
0
0
0
X
 
 
20023
SIIIA monomer
109
52
26
0
X
 
 
20022
metastin analog
55
0
0
0
X
 
 
20020
PND_LAI
99
0
0
0
X
 
 
20019
PND MN
86
0
0
0
X
 
 
20018
Temporin-SHc
82
52
0
0
X
 
 
20017
Temporin-SHb
84
51
0
0
X
 
 
20016
Temporin-SHa
81
48
0
0
X
 
 
20015
PND SF2
73
4
0
0
X
 
 
20014
CAPISTRUIN
96
0
0
0
X
 
 
20013
PFR peptide
76
0
0
0
X
 
 
20012
PFR peptide
76
0
0
0
X
 
 
20009
CLN025
62
0
0
0
X
 
 
20008
L7P Con-T
42
0
0
0
X
 
 
20007
Conopressin-T
42
0
0
0
X
 
 
20005
Leu-enkephalin
24
24
0
0
X
 
 
20004
Leu-enkephalin
24
24
0
0
X
 
 
20003
Leu-enkephalin
24
24
0
0
X
 
 
20002
RgIA
77
0
0
0
X
 
 
20001
odorranalectin
92
0
0
0
X
 
 
19998
sodium channel toxin Hd1a
204
138
38
0
X
 
 
19996
ROQ-Tnf
166
444
166
0
X
 
X
19995
LysRS Anticodon Binding Domain 72-207
102
317
102
0
X
 
 
19994
protein YgaP from Escherichia coli
228
12
61
0
X
 
 
19993
LysRS1-72
206
166
61
0
X
 
 
19992
Kelch domain
252
0
252
0
X
 
 
19991
iron-sulphur cluster
610
486
110
0
X
 
 
19989
N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1
488
225
74
0
X
 
 
19988
PR domain of FOG-1
606
474
109
0
X
 
 
19987
MIT1 domain of a chitin synthase
406
278
73
0
X
 
 
19986
Xenopus RecQ4 zinc knuckle
132
43
21
0
X
 
 
19985
PpcD
479
205
78
0
X
 
 
19984
BlLPMO10A
907
675
177
0
X
 
 
19982
NPM-N (Nucleophosmin) pentamer
122
300
122
0
X
 
 
19981
CnA-VIVIT
127
0
127
0
X
 
 
19980
CnA free
124
0
124
0
X
 
 
19979
B24G insulin
215
0
0
0
X
 
 
19978
[AibB8,LysB28,ProB29]-insulin analogue
292
0
0
0
X
 
 
19977
human HCN2 CNBD in the cAMP-unbound state
927
624
149
0
X
 
 
19974
BA42 protein
823
638
145
0
X
 
 
19973
potent antifungal peptide Cm-p5
77
46
11
0
X
 
 
19971
CupS
841
647
156
0
X
 
 
19970
Enterocin NKR-5-3B
263
154
62
0
X
 
 
19968
tandem PHD fingers of CHD4
698
474
128
0
X
 
 
19966
N-terminus of SOCS5
392
232
63
0
X
 
 
19963
Bitistatin_B
459
172
86
0
X
 
 
19962
Truncated L126Z-sod1
252
230
117
0
X
 
 
19961
SUMO Dimer in Complex with SIM2-3 from RNF4
765
484
113
0
X
 
 
19960
Human Chemokine CCL19
471
267
77
0
X
 
 
19959
Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation
255
121
36
0
X
 
 
19958
N-terminal Domain of Enzyme I
137
0
279
0
X
 
 
19957
DNA-MC1
787
78
103
0
X
X
 
19955
tandem SH3 domain of CAP
830
551
132
0
X
 
 
19954
Nrd1p CID - Trf4p NIM complex
789
374
152
0
X
 
 
19953
V domain of RAGE in complex with IOR
529
345
92
0
X
 
 
19952
StAR D6
1143
878
201
0
X
 
 
19951
apoE(195-299)
188
306
94
0
X
 
 
19947
Bitistatin_A
463
201
77
0
X
 
 
19946
cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP
554
303
112
0
X
 
 
19945
FldA in complex with flavin
927
739
184
0
X
 
 
19943
inner membrane protein YgaP
563
306
112
0
X
 
 
19942
terminal Ig-like domain from Leptospira interrogans LigB
451
368
91
0
X
 
 
19941
TM domain of LAMP-2A
177
159
37
0
X
 
 
19940
ompa
143
463
143
0
X
 
 
19939
MBD4 methyl-cytosine binding domain bound to methylated DNA
474
291
75
0
X
X
 
19938
putative thioredoxin (ECH_0218) in the oxidized state
578
352
117
0
X
 
 
19937
Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide bound
126
126
0
0
X
 
 
19936
Dual-phosphorylated human p38 alpha MK2 334/D peptide bound
145
145
0
0
X
 
 
19935
Dual-phosphorylated human p38 alpha ADP-bound
126
126
0
0
X
 
 
19934
p38_2P_apo
154
154
0
0
X
 
 
19933
novel human tachykinin Hemokinin-1 (hHK1)
46
0
0
0
X
 
 
19932
peptide ImI1
63
0
0
0
X
 
 
19931
DC-SIGN
122
364
122
0
X
 
 
19930
p38-0P apo
154
154
0
0
X
 
 
19929
HP24stab derived from the villin headpiece subdomain
145
79
24
0
X
 
 
19928
BamA-P4P5
813
654
175
0
X
 
 
19925
DNA dodecamer with A:C mismatch
72
0
0
0
 
X
 
19922
TDP-43 RRM2
69
221
69
0
X
 
 
19921
hIFABP-oleate complex
784
454
158
0
X
 
 
19917
DNA dodecamer containing the 5-hydroxycytosine
70
0
0
0
 
X
 
19916
cold shock protein, TaCsp with dT7
348
155
66
0
X
 
 
19915
cold shock protein, TaCsp
348
155
66
0
X
 
 
19914
KDM5B PHD1 finger in complex with H3K4me0(1-10aa)
338
165
51
0
X
 
 
19913
KDM5B PHD1 finger
258
189
51
0
X
 
 
19912
DNA duplex
142
0
0
0
 
X
 
19911
HP24wt derived from the villin headpiece subdomain
127
73
18
0
X
 
 
19910
P22S mutant of N-terminal CS domain of human Shq1
481
366
90
0
X
 
 
19906
EDB and specific binding aptide
549
328
104
0
X
 
 
19905
phosphorylated 4E-BP2 monomer
216
299
0
0
X
 
 
19904
PPIase domain of TbPar42
686
473
122
0
X
 
 
19902
P15 FLiPS
104
39
20
0
X
 
 
19901
Thymosin alpha 1
145
81
29
0
X
 
 
19893
Q4D059, a hypothetical protein from Trypanosoma cruzi
426
335
84
0
X
 
 
19892
OUTER MEMBRANE PROTEIN X IN NANODISC
118
0
117
0
X
 
 
19891
Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4
578
459
118
0
X
 
 
19890
CGACTAGTCG dimer
82
0
0
0
 
X
 
19889
CGACTAGTCG with AIK-18/51-1
96
0
0
0
 
X
 
19888
CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN
82
0
0
0
 
X
 
19887
Oligonucleotide Model of the MiR-21 Pre-Element
100
0
0
0
 
 
X
19886
CGACGCGTCG
98
0
0
0
 
X
 
19885
SENP1
273
609
215
0
X
 
 
19884
CcP
240
757
240
0
X
 
 
19883
peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13
107
60
0
0
X
 
 
19882
a peptoid analogue of maculatin G15 containing cis-Nleu at position 13
102
50
0
0
X
 
 
19881
transport protein m
520
370
90
0
X
 
 
19880
Copsin
302
161
67
0
X
 
 
19879
a computational designed protein based on structure template 1cy5
350
214
57
0
X
 
 
19878
Int-DLP
196
0
0
0
X
 
 
19876
YmoB. A modulator of biofilm formation
734
505
123
0
X
 
 
19875
Pyrin
194
297
93
0
X
 
 
19874
kalata B1[W23WW]
151
0
0
0
X
 
 
19873
D-arm of tRNA(Met)
110
94
0
0
 
 
X
19872
apo form of human glutaredoxin 5
523
484
118
0
X
 
 
19870
6aJL2 Amyloidogenic Light Chain Protein
538
384
98
0
X
 
 
19869
ZapA homodimer
463
266
74
0
X
 
 
19867
M. tuberculosis CrgA membrane protein
0
66
40
0
X
 
 
19866
AbpA
884
687
170
0
X
 
 
19865
LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15
116
0
0
0
X
 
 
19863
AG(7-deaza)G FAPY modified duplex
128
0
0
0
 
X
 
19862
AGC FAPY modified duplex Major isomer
133
0
0
0
 
X
 
19861
AGT FAPY Modified duplex
140
0
0
0
 
X
 
19860
a ribosomal protein
487
360
83
0
X
 
 
19859
GK cecropin-like peptide
196
53
27
0
X
 
 
19858
Phosphorylated Mengovirus Leader Protein
160
161
69
0
X
 
 
19857
Phosphorylated Mengovirus Leader Protein
159
159
69
0
X
 
 
19856
a peptoid analogue of maculatin G15 in DPC micelles
112
68
0
0
X
 
 
19855
Mengovirus Leader Protein Bound to Ran GTPase
160
159
70
0
X
 
 
19854
Mengovirus Leader Protein Bound to Ran GTPase
1150
899
294
0
X
 
 
19853
AGA modified
161
0
0
0
 
X
 
19852
NUCLEOTIDE-FREE HUMAN RAN GTPASE
1137
874
294
0
X
 
 
19851
Unknown protein YP_001712342.1 from Acinetobacter baumannii
642
362
115
0
X
 
 
19850
GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana
178
0
178
0
X
 
 
19849
reduced BolA2 from Arabidopsis thaliana
385
244
95
0
X
 
 
19848
PA3793 from Pseudomonas aeruginosa
607
462
120
0
X
 
 
19847
alpha amylase inhibitor peptide aS1 from Allatide scholaris
167
0
0
0
X
 
 
19846
alpha-amylase inhibitor peptide aS4 from Allatide scholaris
167
0
0
0
X
 
 
19845
Coronavirus Envelope Proteins-1
337
260
63
0
X
 
 
19844
RNase 4
110
210
110
0
X
 
 
19843
ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate
752
541
139
0
X
 
 
19842
eIF4G HEAT2 domain
1181
889
207
0
X
 
 
19841
Ptr ToxB
338
192
69
0
X
 
 
19840
ToxB
320
186
62
0
X
 
 
19837
E. coli Trigger Factor in complex with unfolded PhoA365-471
882
445
345
0
X
 
 
19836
E. coli Trigger Factor in complex with unfolded PhoA1-150
1154
565
479
0
X
 
 
19835
E. coli Trigger Factor in complex with unfolded PhoA220-310
1065
481
444
0
X
 
 
19834
New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein
939
727
215
0
X
 
 
19833
antimicrobial peptide LsbB
196
92
31
0
X
 
 
19832
antimicrobial peptide LsbB
194
98
28
0
X
 
 
19831
CBM3b-Cbh9A
0
504
129
0
X
 
 
19830
reduced Jaburetox
405
297
84
0
X
 
 
19829
CHEMOKINE (C-C MOTIF) RECEPTOR 2
96
39
14
0
X
 
 
19828
CHEMOKINE (C-C MOTIF) RECEPTOR 2
110
71
14
0
X
 
 
19826
sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor
883
660
148
0
X
 
 
19824
Solution structure of a TrkAIg2 domain construct for use in drug discovery
574
441
113
0
X
 
 
19823
Lasso Peptide Caulonodin V
100
0
0
0
X
 
 
19822
B25-(alpha, beta)-dehydro-phenylalanine insulin
277
138
39
0
X
 
 
19821
Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx
338
77
77
0
X
 
 
19819
cyanometNgb
290
425
136
0
X
 
 
19818
metNgb
299
427
140
0
X
 
 
19817
mutation G159D in troponin C bound to the anchoring region of troponin I
370
219
75
0
X
 
 
19816
C-domain of troponin C bound to the anchoring region of troponin I
331
216
70
0
X
 
 
19815
COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12A
298
206
50
0
X
 
 
19813
BmKTX-D19K/K6D
216
0
0
0
X
 
 
19811
a computational designed protein based on template of human erythrocytic ubiquitin
445
264
76
0
X
 
 
19810
BmKTX-D19K
222
0
0
0
X
 
 
19809
YSCUCN in a micellar complex with SDS
95
55
55
0
X
 
 
19808
Ginsentide
150
0
0
0
X
 
 
19807
NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.
887
496
157
0
X
 
 
19806
hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483
896
497
158
0
X
 
 
19805
The dsDNA in intact bacteriophage T7
0
39
14
0
 
X
 
19801
monomer1
782
577
146
0
X
 
 
19800
PrgK first periplasmic domain
328
250
57
0
X
 
 
19799
LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis
297
230
59
0
X
 
 
19798
6aJL2-R24G Amyloidogenic Light Chain Protein
577
392
104
0
X
 
 
19797
NA,K-ATPASE REGULATORY PROTEIN FXYD2b
225
169
60
0
X
 
 
19796
hinge monomer
63
174
61
0
X
 
 
19792
RBMX
491
366
92
0
X
 
 
19791
Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH
724
441
121
0
X
 
 
19789
N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I
296
94
82
0
X
 
 
19788
FKBP52
111
341
111
0
X
 
 
19787
FKBP51
250
351
114
0
X
 
 
19784
G-triplex truncated-TBA
119
66
0
9
 
X
 
19783
fourth constant immunoglobulin domain of nurse shark IgNAR
578
394
97
0
X
 
 
19779
Solution structure of the SGTA N-terminal domain
395
303
73
0
X
 
 
19778
CPEB1RRM12 in complex with RNA
692
373
194
0
X
 
X
19777
CPEB4RRM12 in free state
886
463
181
0
X
 
 
19776
CPEB4RRM12 in complex with RNA
955
521
177
0
X
 
X
19775
CPEB1RRM12
1040
563
212
0
X
 
 
19774
tandem UIMs of wild-type RAP80
104
152
55
0
X
 
 
19773
E81 deletion mutant from RAP80 tandem UIMs
114
113
58
0
X
 
 
19771
CPEB1ZZ
306
173
59
0
X
 
 
19769
Z-L2LBT variant A
61
161
61
0
X
 
 
19768
hDkk4
882
683
185
0
X
 
 
19767
fibrils
0
79
28
0
X
 
 
19766
Heterotrimeric pre-mRNA Retention and Splicing Complex
1026
705
180
0
X
 
 
19765
gbvb5
149
0
0
0
X
 
 
19764
dimeric transmembrane domain of Toll-like receptor 3
224
168
34
0
X
 
 
19763
MS1
207
0
207
0
X
 
 
19759
Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain
101
62
10
0
X
 
 
19758
RPAP3
758
537
132
0
X
 
 
19757
RPAP3
715
501
126
0
X
 
 
19755
MecA
528
409
90
0
X
 
 
19754
DAGK
0
369
94
0
X
 
 
19753
Plectin repeat domain 6
335
662
195
0
X
 
 
19752
LysGH15
739
560
136
0
X
 
 
19751
ORF2
646
416
119
0
X
 
 
19750
gp41 ectodomain monomer on a DPC micelle
125
195
68
0
X
 
 
19749
N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)
572
427
112
0
X
 
 
19748
Lactodifucotetraose (LDFT) beta anomer
30
24
0
0
 
 
 
19747
M13 bacteriophage
0
238
53
0
X
X
 
19746
synthetic Mamba-1 peptide
236
0
0
0
X
 
 
19745
DNA (28-MER)
212
0
0
0
 
X
 
19744
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
235
486
235
0
X
 
 
19743
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
300
486
236
0
X
 
 
19742
Dimethylarginine Dimethylaminohydrolase
235
486
235
0
X
 
 
19741
p75-TM-C257A
220
125
42
0
X
 
 
19740
CYP101
306
960
297
0
X
 
 
19739
Calcium Bound S100P - V Domain of RAGE complex
373
214
81
0
X
 
 
19738
second bromodomain of Brd4 with Di-acetylated Twist peptide
754
454
118
0
X
 
 
19737
C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)
899
472
194
0
X
 
 
19736
1-C-Grx1
735
594
132
0
X
 
 
19735
TIA-1 RRM2,3 monomer
1073
767
198
0
X
 
 
19734
fd bacteriophage
0
39
0
5
X
X
 
19733
trimeric Skp
14
14
0
0
X
 
 
19732
NLRC5 caspase recruitment domain (CARD)
576
429
99
0
X
 
 
19731
peptidyl-tRNA hyrolase from Vibrio cholerae
1053
826
182
0
X
 
 
19730
trimeric Skp with bound tOmpA
13
13
0
0
X
 
 
19729
HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)
253
0
0
0
X
 
 
19728
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
112
0
0
0
 
X
 
19727
HIFABP Ketorolac complex
694
434
126
0
X
 
 
19726
GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'
856
386
144
0
X
 
X
19725
Ig-alpha YE variant Ig-beta construct
188
0
95
0
X
 
 
19724
Ig-alpha Ig-beta construct
249
119
83
0
X
 
 
19723
Ig-alpha Ig-beta construct
187
236
95
0
X
 
 
19722
H83A apo HasAp
154
163
154
0
X
 
 
19721
Y75A apo HasAp
149
164
149
0
X
 
 
19720
WT apo HasAp
164
173
164
0
X
 
 
19719
PFI1780w-PHIST
404
419
148
0
X
 
 
19718
Yah1 reduced
362
347
83
0
X
 
 
19717
Yah1 Oxidized
386
398
100
0
X
 
 
19716
Zn-binding domain of eukaryotic translation initiation factor 3, subunit G
130
78
24
0
X
 
 
19715
Receiver domain of ethylene receptor ETR1
686
539
136
0
X
 
 
19714
Transport protein A
520
378
90
0
X
 
 
19713
Domain-Swapped GLPG
343
193
69
0
X
 
 
19712
Designed Exendin-4 analogues
222
0
0
0
X
 
 
19711
native split Npu DnaE intein
713
536
136
0
X
 
 
19710
CDYL2 chromodomain
322
232
54
0
X
 
 
19709
HR8998C
794
584
147
0
X
 
 
19708
VSD-Q1
137
278
137
0
X
 
 
19707
extracellular sensor domain of DraK histidine kinase
499
361
93
0
X
 
 
19704
Neurotoxin II from snake venom Naja Oxiana
380
282
83
0
X
 
 
19703
Iron-sulfur cluster binding protein from Ehrlichia chaffeensis
465
393
98
0
X
 
 
19702
dimerization domain of the human polyoma, JC virus agnoprotein
218
0
0
0
X
 
 
19701
soluble A 17-34 peptide
84
0
0
0
X
 
 
19700
P33A mutant of non-conventional toxin WTX from Naja kaouthia
414
0
74
0
X
 
 
19699
m04/gp34 mouse Cytomegalovirus Immunoevasin core domain
143
411
143
0
X
 
 
19698
preQ1 Class II riboswitch from Streptococcus pneumoniae
345
245
20
0
 
 
X
19697
novel venom peptide toxin from sample limited terebrid marine snail
97
46
0
0
X
 
 
19696
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
154
0
0
0
 
X
 
19695
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
151
0
0
0
 
X
 
19694
FHL2 LIM adaptor and its Interaction with Ski
535
303
101
0
X
 
 
19693
oxidized dimeric form of human defensin 5
334
236
62
0
X
 
 
19692
Divalent Cations at the Active Site of the Neurospora VS Ribozyme
232
173
91
0
 
 
X
19689
SiCYS
1125
788
201
0
X
 
 
19688
Tah1Pih1
673
490
105
0
X
 
 
19687
immune signalling subunit
695
408
144
0
X
 
 
19686
ASD-1+RNA
87
185
87
0
X
 
X
19685
RRM3 intermediate state
490
396
107
0
X
 
 
19684
HR9129A
373
270
66
0
X
 
 
19683
S-linked glycopeptide sublancin 168
184
65
42
0
X
 
 
19682
Zinc finger-PHD-type 1 domain_number-1
530
392
95
0
X
 
 
19681
E. coli LpoB
953
756
197
0
X
 
 
19680
ASD-1
171
277
86
0
X
 
 
19679
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7
68
39
9
0
X
 
 
19678
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5
61
32
13
0
X
 
 
19677
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4
53
23
11
0
X
 
 
19675
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44
61
29
10
0
X
 
 
19674
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10
62
38
11
0
X
 
 
19673
p75 transmembrane domain
233
170
42
0
X
 
 
19672
Dok1 PTB domain monomer
181
95
86
0
X
 
 
19671
3rC34Y
390
273
91
0
X
 
 
19670
lysine-free (K0) ubiquitin
254
219
70
0
X
 
 
19669
Ms-NbGRP2 monomer
103
190
103
0
X
 
 
19668
a3Y monomer
435
309
65
0
X
 
 
19667
carboxyterminal domain of NusG
356
263
60
0
X
 
 
19666
DC1A
342
245
60
0
X
 
 
19664
EcDsbA-sulfonamide complex
105
106
0
0
X
 
 
19663
Somatostatin-14
66
0
0
0
X
 
 
19662
I-V kissing-loop interaction of the Neurospora VS ribozyme
231
186
67
0
 
 
X
19661
SHB modified duplex
198
0
0
0
 
X
 
19660
pmf-g
302
171
56
0
X
 
 
19659
RHB Modified duplex
201
0
0
0
 
X
 
19658
maximin-4
144
0
0
0
X
 
 
19657
Penicillium Antifungal Protein PAF
303
203
59
0
X
 
 
19656
CD79b cytosolic domain phosphorylated
47
138
47
0
X
 
 
19655
CD79b cytosolic domain phosphorylated
48
139
48
0
X
 
 
19654
human Mcl-1
965
548
175
0
X
 
 
19653
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
633
420
99
0
X
X
 
19651
CD79b cytosolic domain denatured
48
139
48
0
X
 
 
19650
CD79b cytosolic domain
48
139
48
0
X
 
 
19649
CD79a cytosolic domain phosphorylated
60
173
60
0
X
 
 
19648
CD79a cytosolic domain phosphorylated
60
172
60
0
X
 
 
19646
major factor VIII binding region on von Willebrand factor
501
287
85
0
X
 
 
19645
CD79a cytosolic domain
60
173
60
0
X
 
 
19644
CD79a cytosolic domain
59
170
59
0
X
 
 
19643
5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997
531
296
90
0
X
 
 
19642
RBM39_RRM1
523
385
95
0
X
 
 
19641
3rCWP7D
467
322
107
0
X
 
 
19638
cytochrome c Y67H
573
0
0
0
X
 
 
19637
Outer Membrane Protein X from E. coli
177
470
177
0
X
 
 
19635
Pseudomonas aeruginosa Tps4 two-partner secretion system
499
388
83
0
X
 
 
19634
CR4/5 domain of medaka telomerase RNA
463
335
65
0
 
 
X
19633
EF-hand domain from sea urchin polycystin-2
504
386
104
0
X
 
 
19632
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
446
241
73
0
X
 
 
19629
Cyanobacterial GAF domain
213
357
132
0
X
 
 
19628
protein NP_419126.1 from CAULOBACTER CRESCENTUS
409
302
74
0
X
 
 
19627
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
665
380
113
0
X
 
 
19626
rsahit
810
596
149
0
X
 
 
19625
TNPX
704
494
130
0
X
 
 
19624
circular sortase A
772
0
159
0
X
 
 
19623
GA-79-MBP cs-rosetta structures
112
162
55
0
X
 
 
19622
PetF monomer
479
371
88
0
X
 
 
19621
CNBHD
683
554
137
0
X
 
 
19620
DNA duplex containing N3T-ethylene-N1I
120
0
0
0
 
X
 
19619
lantibiotic NAI-107
104
40
0
0
X
 
 
19618
transport protein
603
469
116
0
X
 
 
19617
Big domain from Leptospira interrogans
366
248
92
0
X
 
 
19616
Dimethylarginine Dimethylaminohydrolase
238
486
237
0
X
 
 
19615
PaDDAH_TM
239
481
235
0
X
 
 
19614
basic-helix-loop-helix region of the transcriptional repressor HES-1
828
604
142
0
X
 
 
19613
HOP2
411
310
82
0
X
 
 
19611
Enzymatic cyclisation of kalata B1 using sortase A
156
74
0
0
X
 
 
19610
p300 Taz2:ETAD1 complex
721
558
134
0
X
 
 
19609
Protein-RNA Ternary Complex
987
575
184
0
X
 
X
19608
mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195
952
738
169
0
X
 
 
19607
C-terminal domain of SRA1p
645
536
130
0
X
 
 
19606
UBA Domain of Human NBR1
290
176
50
0
X
 
 
19605
PASTA domain of PonA2
324
245
61
0
X
 
 
19604
complex of calmodulin with minimal binding domain from HIV-1 matrix protein
1059
632
197
0
X
 
 
19603
ctrdpc
96
0
0
0
X
 
 
19602
dimer of the metal binding domain 1-16 of human amyloid beta-peptide in complex with Zinc
105
56
16
0
X
 
 
19601
CXCL5
218
138
70
0
X
 
 
19600
CEH37 Homeodomain
375
199
64
0
X
 
 
19599
hman EPRS R12 repeats
711
520
136
0
X
 
 
19598
WHEP repeats
1072
768
211
0
X
 
 
19597
Ctrr_sds
98
0
0
0
X
 
 
19596
pdx1c
272
261
74
0
X
 
 
19595
oxytocin
52
24
0
0
X
 
 
19594
G-quadruplex bound to the bisquinolinium compound Phen-DC3
194
0
0
0
 
X
 
19593
Truncated EGF-A
136
62
0
0
X
 
 
19592
Molecular Binding of TFF1 Estrogen Response Element
287
0
0
0
 
X
 
19591
FF domain L24A mutant
0
203
0
0
X
 
 
19590
Fyn_SH3_G48A
0
164
0
0
X
 
 
19589
RhoGAP
1167
853
210
0
X
 
 
19587
alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19586
Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495
829
397
145
0
X
 
 
19585
computational designed dimer based on the engrailed homeodomain structure
374
260
63
0
X
 
 
19584
Dvl-2 DEP
92
274
92
0
X
 
 
19583
peptide derived from the membrane proximal external region of HIV-1 gp41
203
20
0
0
X
 
 
19582
peptide derived from the membrane proximal external region of HIV-1 gp41
203
87
0
0
X
 
 
19581
peptide derived from the trans-membrane region of HIV-1 gp41
179
94
0
0
X
 
 
19580
PAP262-270 in SDS micelles
60
0
0
0
X
 
 
19579
C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)
571
463
130
0
X
 
 
19578
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1
30
31
11
0
X
 
 
19577
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1
30
31
13
0
X
 
 
19576
FAPP1 PH domain monomer
97
274
97
0
X
 
 
19575
Tubule
0
603
188
0
X
 
 
19573
XANTHOMONIN II
67
0
0
0
X
 
 
19572
quadruplex d(TGGGTTTGGGTTGGGTTTGGG)
180
0
0
0
 
X
 
19571
d(GGGTTTTGGGTGGGTTTTGGG) quadruplex
176
0
0
0
 
X
 
19570
cactus-derived antimicrobial peptide Ep-AMP1
186
62
0
0
X
 
 
19569
Vps28C
582
433
105
0
X
 
 
19568
ISUR
98
136
46
0
X
 
 
19567
DHFR
262
418
172
0
X
 
 
19566
DHFR
262
275
167
0
X
 
 
19565
DHFR
260
260
170
0
X
 
 
19564
DHFR
267
275
170
0
X
 
 
19563
DHFR
168
180
168
0
X
 
 
19562
FRS2a PTB domain with neurotrophin receptor TrkB
720
419
134
0
X
 
 
19561
Taf-RRM-RanBP
146
414
146
0
X
 
 
19560
Middle domain of Hsp90alpha
404
1181
404
0
X
 
 
19559
MS1
126
237
126
0
X
 
 
19558
Crc
318
825
235
0
X
 
 
19557
circular g-domain analog from the wheat metallothionein Ec-1
114
0
0
0
X
 
 
19556
C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1
67
25
14
0
X
 
 
19555
C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11
58
26
12
0
X
 
 
19554
Domain 2 of E. coli ribosomal protein S1
870
668
174
0
X
 
 
19553
Blo 1 12 CBD domain
392
292
66
0
X
 
 
19552
Blo t 19, a minor dust mite allergen from Blomia tropicalis
357
253
77
0
X
 
 
19551
hFKBP25 monomer
1394
945
229
0
X
 
 
19550
S1F1
533
389
95
0
X
 
 
19549
RsmZ(36-44)/RsmE(dimer) 2:1 complex
437
274
70
0
X
 
X
19548
RsmZ(SL4)/RsmE(dimer) 2:1 complex
543
355
81
0
X
 
X
19547
RsmZ(SL3)/RsmE(dimer) 2:1 complex
533
346
76
0
X
 
X
19546
RsmZ(SL2)/RsmE(dimer) 2:1 complex
528
346
78
0
X
 
X
19545
cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03
190
132
17
0
 
 
X
19544
RsmZ(SL1)/RsmE(dimer) 2:1 complex
552
360
78
0
X
 
X
19542
Mambalgin-2
329
143
58
0
X
 
 
19541
Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39
621
290
104
0
X
 
 
19540
MyT1 F4F5 - DNA complex
51
115
51
0
X
X
 
19539
acp5b
473
357
93
0
X
 
 
19538
IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAE
792
451
129
0
X
 
 
19536
acp5a
463
364
88
0
X
 
 
19535
SGTX-Sf1a
255
182
49
0
X
 
 
19534
non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex
140
120
20
0
X
 
X
19533
NusE (S10) from Thermotoga maritima
418
316
68
0
X
 
 
19532
mutant dimeric TM domain of VEGFR2 receptor
236
181
44
0
X
 
 
19531
trimeric mutant TM domain of VEGFR2 receptor
236
171
44
0
X
 
 
19530
BLM RQC
660
324
120
0
X
 
 
19528
DOUBLE GS-TAMAPIN MUTATION R6A R7A
174
0
0
0
X
 
 
19527
GS-TAMAPIN MUTATION R13A
177
0
0
0
X
 
 
19526
SLED domain of Scml2
635
468
115
0
X
 
 
19525
Solution structure of the Nt. GR-RBP1 RRM domain
479
362
93
0
X
 
 
19524
GS-TAMAPIN MUTATION R7A
183
0
0
0
X
 
 
19523
N-terminal domain of Bilbo1 from Trypanosoma brucei
493
409
107
0
X
 
 
19522
Complex Between BCL-xL and the p53 Core Domain
273
646
209
0
X
 
 
19521
BCL-xL containing the alpha1-alpha2 disordered loop
865
642
209
0
X
 
 
19520
BCL-xL in its p53-bound conformation
273
646
209
0
X
 
 
19519
GS-TAMAPIN MUTATION R6A
180
0
0
0
X
 
 
19518
RLC/MyBS
1148
788
203
0
X
 
 
19517
E1TM
33
91
33
0
X
 
 
19516
Dot1L-AF9 complex
522
414
89
0
X
 
 
19515
MPER-PB7
193
145
31
0
X
 
 
19514
MPER-Du151
192
112
34
0
X
 
 
19513
MPER-Con089
189
112
32
0
X
 
 
19512
MPER-HxB2-AA
187
142
32
0
X
 
 
19511
homeodomain transcription factor Gbx1
425
248
75
0
X
X
 
19510
Z-subunit
510
381
103
0
X
 
 
19508
human wild type FAPP1-PH domain
570
400
113
0
X
 
 
19507
CFP10 Monomer
109
317
109
0
X
 
 
19506
Human eRF1
305
516
299
0
X
 
 
19505
WW Domain Strand-Swapped Dimer
182
0
0
0
X
 
 
19504
baa38
248
0
0
0
X
 
 
19503
WW Domain with Loop 1 Excised
211
0
0
0
X
 
 
19502
dsRBD3
514
284
93
0
X
 
 
19501
Novel 4/7-Conotoxin LvIA
73
40
0
0
X
 
 
19500
HUR RRM3
224
311
110
0
X
 
 
19499
HUR RRM3
246
297
118
0
X
 
 
19498
bacteriophage T7 encoded inhibitor (gp1.2)
406
266
75
0
X
 
 
19497
Ca free domain 6 of villin
372
321
100
0
X
 
 
19496
FLNa3-5
398
670
258
0
X
 
 
19495
FLNc4-5
265
495
169
0
X
 
 
19494
HUR RRM3
184
204
109
0
X
 
 
19493
purotoxin-2
351
0
0
0
X
 
 
19491
Galectin-3
1467
1260
336
0
X
 
 
19490
cdN dimer
188
565
188
0
X
 
 
19489
MSP-P56S DOMAIN/VAPB
522
230
118
0
X
 
 
19488
WW domain with polyproline stretch (PP2WW) of HYPB
208
150
46
0
X
 
 
19487
PP2WW mutant (KPP2WW) of HYPB
221
174
49
0
X
 
 
19486
Hr7298f
291
212
51
0
X
 
 
19485
SVIP mutation
411
280
67
0
X
 
 
19484
tm67
295
0
0
0
X
 
 
19483
WW domain of HYPB
190
147
44
0
X
 
 
19482
Regulatory Domain of Tyrosine Hydroxylase
460
358
88
0
X
 
 
19481
RDTH dimer
127
223
127
0
X
 
 
19480
RDTH dimer
123
217
123
0
X
 
 
19479
Active Site Mutant Pepitdyl Carrier Protein
482
292
79
0
X
 
 
19478
TNRC6Bm1
73
139
73
0
X
 
 
19477
P130Cas SD
238
0
238
0
X
 
 
19476
CONOTOXIN LO1A
95
48
0
0
X
 
 
19474
uninhibited ETV6 ETS domain
632
349
101
0
X
 
 
19473
Sp140 PHD finger cis conformer
318
159
53
0
X
 
 
19472
Sp140 PHD finger trans conformer
313
159
52
0
X
 
 
19471
WG12_LPS
61
0
0
0
X
 
 
19470
KR8_LPS
35
0
0
0
X
 
 
19469
WK10_LPS
55
0
0
0
X
 
 
19468
WR17_LPS
90
0
0
0
X
 
 
19464
HicA
285
176
50
0
X
 
 
19463
p87m-HlyIIc
571
377
112
0
X
 
 
19462
HlyIIC-Trans
261
193
59
0
X
 
 
19461
HlyIIC-Cis
555
371
113
0
X
 
 
19460
ShK-like immunomodulatory peptide from Ancylostoma caninum
275
196
56
0
X
 
 
19459
Recombinant CR1 fragment, domains 1-2
623
518
121
0
X
 
 
19458
Recombinant CR1 fragment, domains 2-3
249
152
67
0
X
 
 
19457
piscidin 3 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers
0
0
21
0
X
 
 
19456
piscidin 3 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers
0
0
21
0
X
 
 
19455
piscidin 1 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers
0
0
21
0
X
 
 
19454
piscidin 1 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers
0
0
22
0
X
 
 
19453
SP17945A
600
325
108
0
X
 
 
19452
putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis
512
410
109
0
X
 
 
19451
PNUTS
64
114
64
0
X
 
 
19450
ShK-like immunomodulatory peptide from Brugia malayi
196
118
40
0
X
 
 
19449
BolA-like hypothetical protein RP812
403
320
80
0
X
 
 
19448
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
196
0
0
0
 
X
 
19447
Ubiquitin Binding with SH3 domains
132
0
132
0
X
 
 
19446
SSB
810
701
178
0
X
 
 
19444
murine norovirus CR6 NS1/2 protein
317
109
52
0
X
 
 
19443
EC1
117
310
117
0
X
 
 
19442
E7 dimer
39
126
42
0
X
 
 
19441
spermine modified DNA duplex
141
0
0
14
 
X
 
19440
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
136
0
0
14
 
X
 
19439
murine norovirus NS1/2 CW3 WT
305
108
51
0
X
 
 
19438
Tgam
295
417
136
0
X
 
 
19437
mammalian tachykinin neuropeptide gamma
91
0
0
0
X
 
 
19436
murine norovirus NS1/2 D94E mutant
453
307
75
0
X
 
 
19435
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
196
0
0
0
 
X
 
19433
YP_002937094.1
581
339
112
0
X
 
 
19432
Cat r 1
781
507
166
0
X
 
 
19431
hypothetical protein
693
398
121
0
X
 
 
19430
Salmonella MgtR
0
0
8
0
X
 
 
19429
bacteriophage transcription regulator complex with p7 peptide
386
289
66
0
X
 
 
19428
entity
357
272
64
0
X
 
 
19427
BldD-CTD monomer
489
368
88
0
X
 
 
19426
kv14_pep61
271
210
56
0
X
 
 
19425
mouse RyR2 domain A
185
541
185
0
X
 
 
19424
RyR2A delta exon 3
145
276
145
0
X
 
 
19423
Vav1 SH2 domain complex
563
315
92
0
X
 
 
19422
Nosiheptide in Complex with TipAS
859
600
153
0
X
 
 
19421
Promothiocin A in Complex with TipAS
850
600
157
0
X
 
 
19419
C-Ala domain of alanyl-tRNA synthetase
718
530
130
0
X
 
 
19417
PaDsbA
1009
591
176
0
X
 
 
19416
Rrp7 C-terminal Domain
318
218
49
0
X
 
 
19415
LMO4-LIM2 in complex with DEAF-1 (404-418)
522
354
103
0
X
 
 
19414
PaDsbA
51
42
0
0
X
 
 
19413
KpDsbA
1016
596
185
0
X
 
 
19412
K11-linked Diubiquitin
138
0
138
0
X
 
 
19411
OmpX within the trimeric chaperone Skp
129
236
129
0
X
 
 
19410
tOmpA within the tirmeric chaperone Skp
167
424
167
0
X
 
 
19409
Trimeric Skp with bound tOmpA
147
0
147
0
X
 
 
19408
trimeric Skp with bound OmpX
149
283
149
0
X
 
 
19407
trimeric Skp
133
257
133
0
X
 
 
19406
K11-linked Diubiquitin
140
0
140
0
X
 
 
19404
OR33_cns
694
504
110
0
X
 
 
19403
Clip-segment of the von Willebrand domain 1 of Crossveinless 2
347
195
63
0
X
 
 
19402
antiparallel (2+2) G-quadruplex
229
0
0
0
 
X
 
19400
The structure of the Box CD enzyme reveals regulation of rRNA methylation
0
0
0
0
X
 
X
19399
EKLF(22-40)/Ubiquitin Complex
583
339
101
0
X
 
 
19398
Forkhead DNA binding domain of Brugia malayi DAF-16a
609
423
109
0
X
 
 
19397
FAT10 first domain
238
0
52
0
X
 
 
19396
Lasiocepsin
180
90
25
0
X
 
 
19395
human holo-PRL-3 in complex with vanadate
761
427
130
0
X
 
 
19394
human Polymerase iota UBM1-Ubiquitin Complex
1045
582
184
0
X
 
 
19393
Abeta Fibrils
0
187
49
0
X
 
 
19392
CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly
637
466
116
0
X
 
 
19391
MBD3
391
309
68
0
X
X
 
19390
EBNA-2 N-terminal Dimerization (END) domain
337
211
54
0
X
 
 
19389
stacked dimeric G-quadruplex
134
0
0
0
 
X
 
19387
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
240
0
0
23
 
X
 
19386
parallel-stranded G-quadruplex in DNA poly-G stretches
164
0
0
0
 
X
 
19385
conotoxin muPIIIA-2
141
0
0
0
X
 
 
19384
conotoxin muPIIIA-1
127
0
0
0
X
 
 
19383
Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2
281
190
47
0
X
 
 
19382
hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'
604
293
97
0
X
 
X
19381
DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')
186
0
0
0
 
X
 
19380
RNAP_alpha_subunit_CTD
626
340
112
0
X
 
 
19379
alpha7 nAChR transmembrane domain
534
473
128
0
X
 
 
19377
IL10 dimer
214
457
152
0
X
 
 
19376
Calmodulin, C-terminal domain
434
319
78
0
X
 
 
19375
N2-dG IQ at G3 in NarI sequence
213
0
0
0
 
X
 
19374
alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa
166
0
0
0
X
 
 
19372
Ani s 5 Anisakis simplex allergen
694
418
125
0
X
 
 
19371
calbindin D9k magnesium bound-form
69
212
69
0
X
 
 
19370
calbindin D9k calcium bound-form
69
218
69
0
X
 
 
19369
calbindin D9k Apo-form
71
219
71
0
X
 
 
19368
Structure of Pex14 in complex with Pex5 LVxEF motif
409
212
62
0
X
 
 
19367
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
560
317
103
0
X
X
 
19366
region 2 of E. coli sigmaE
572
334
108
0
X
 
 
19365
Lipid Transfer Protein from Lentil Lens Culinaris
503
271
97
0
X
 
 
19364
Nupr1
78
247
86
0
X
 
 
19363
STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains
617
425
105
0
X
 
 
19362
STIM1 CC1-CC2 homodimer
485
357
78
0
X
 
 
19358
Val66 BDNF Prodomain
85
263
85
0
X
 
 
19357
Met66 BDNF Prodomain
85
264
85
0
X
 
 
19356
MS6
413
274
91
0
X
 
 
19355
Lassomycin
91
55
19
0
X
 
 
19354
Smoothened
798
556
125
0
X
 
 
19353
AS69_ASyn
620
450
113
0
X
 
 
19351
acetylated aSyn A53T monomer
133
400
133
0
X
 
 
19350
acetylated aSyn monomer
133
398
133
0
X
 
 
19349
aSyn mouse_T53A&N87S monomer
122
382
122
0
X
 
 
19348
aSyn mouse_N87S monomer
128
389
128
0
X
 
 
19347
aSyn_mouse_T53A
126
389
126
0
X
 
 
19346
aSyn_mouse
128
388
128
0
X
 
 
19345
aSyn_A53T&S87N
123
386
123
0
X
 
 
19344
aSyn_S87N
128
397
128
0
X
 
 
19343
OPA60 FROM N. GONORRHOEAE
106
316
106
0
X
 
 
19342
Transmembrane-cytosolic part of Trop2
175
79
25
0
X
 
 
19340
C-Terminal Domain of AciniformSpidroin
575
330
121
0
X
 
 
19338
aSyn A53T monomer
126
385
126
0
X
 
 
19337
aSyn
128
395
128
0
X
 
 
19336
5P12-RANTES-E66S
63
172
66
0
X
 
 
19335
5P12-RANTES-E66S
63
184
68
0
X
 
 
19334
Temporin-1 Ta in lipopolysaccharide micelles
56
0
0
0
X
 
 
19333
HIV-1 Vif SOCS-box with Elongin BC
250
417
160
0
X
 
 
19332
p15(PAF)
225
422
107
0
X
 
 
19331
HR7992A
375
265
76
0
X
 
 
19330
DUSP16 Monomer
123
379
123
0
X
 
 
19329
HR8700A
359
268
68
0
X
 
 
19328
HR7375C
340
251
62
0
X
 
 
19327
yahO
431
318
75
0
X
 
 
19325
26S proteasome subunit monomer
1086
811
208
0
X
 
 
19324
FKBP12.6
217
307
98
0
X
 
 
19323
FKBP12.6
218
307
98
0
X
 
 
19322
LTBP1-cb14TB3
459
0
236
0
X
 
 
19321
cerato populin
704
528
135
0
X
 
 
19320
Taf15
547
412
100
0
X
 
 
19319
RasGRP2 EF hands bound to calcium
326
303
77
0
X
 
 
19318
drSTIL
112
172
50
0
X
 
 
19317
DNA helicase RecQ
415
283
70
0
X
 
 
19315
HHARI Catalytic Domain
380
222
87
0
X
 
 
19314
HR9151A
601
453
98
0
X
 
 
19312
hr4784b
331
253
62
0
X
 
 
19311
Saccharomyces cerevisiae Est3 protein
218
568
151
0
X
 
 
19309
complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside
220
0
0
0
X
 
 
19308
UVI31+
106
321
106
0
X
 
 
19307
UVI31+Mg
106
321
106
0
X
 
 
19306
an inhibitor bound dengue NS3 protease
369
712
217
0
X
 
 
19305
an inhibitor bound dengue NS3 protease
369
712
217
0
X
 
 
19304
kalata B7
154
0
0
0
X
 
 
19303
(HhH)2 domain of human FAAP24
333
196
56
0
X
 
 
19302
ERCC4 domain of human FAAP24
707
542
131
0
X
 
 
19301
CPR
181
523
181
0
X
 
 
19300
protoxin-1
190
81
32
0
X
 
 
19299
MLV CTD IN
396
334
74
0
X
 
 
19298
RBPMS2-Nter
182
256
85
0
X
 
 
19297
holo DC-SIGNR CRD
451
431
116
0
X
 
 
19296
Pin1 WW domain mutant 6-1g
231
0
0
0
X
 
 
19295
Pin1 WW domain variant 6-1
222
0
0
0
X
 
 
19294
DNA-binding domain of T. brucei telomeric protein tbTRF
97
0
98
0
X
 
 
19293
calcium-bound human S100A12
379
296
75
0
X
 
 
19292
Pin1 WW domain mutant 5-1g
221
0
0
0
X
 
 
19291
Pin1 WW domain mutant 5-1
212
0
0
0
X
 
 
19290
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
1155
864
182
11
X
 
X
19288
HR7784A
529
369
90
0
X
 
 
19287
NACI
300
184
58
0
X
 
 
19286
BeF3 Activated Sma0114
206
71
103
0
X
 
 
19285
Calcium Sensor
143
199
69
0
X
 
 
19283
RXFP2_LDLa
234
107
43
0
X
 
 
19282
lymphocyte receptor NKR-P1A
831
622
157
0
X
 
 
19281
d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
260
0
0
0
 
X
 
19280
d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid
263
0
0
0
 
X
 
19279
d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid
245
0
0
0
 
X
 
19278
d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid
266
0
0
0
 
X
 
19277
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
240
0
0
0
 
X
 
19276
d[CGCGAAGCATTCGCG] hairpin
139
0
0
0
 
X
 
19275
Bovicin HJ50
179
106
0
0
X
 
 
19274
Dictyostelium discodieum Myosin Light Chain, MlcC
431
320
81
0
X
 
 
19273
holo-Ferredoxin
81
241
81
0
X
 
 
19272
YopH
271
760
271
0
X
 
 
19271
CRABP1 apo
130
401
130
0
X
 
 
19270
Sigma-1 receptor chaperone domain
212
297
105
0
X
 
 
19269
E7N
227
133
0
0
X
 
 
19268
HuPRP
800
425
160
0
X
 
 
19267
OEP16
271
443
150
0
X
 
 
19266
SNARE
0
0
0
0
X
 
 
19264
W184AM185A mutant of the HIV-1 capsid protein
206
648
206
0
X
 
 
19263
MPERp
197
7
0
0
X
 
 
19262
MPERp
190
18
0
0
X
 
 
19261
HIV capsid dimer
178
563
178
0
X
 
 
19260
RNA_(48-MER)
339
247
32
0
 
 
X
19259
Pin1
253
182
39
0
X
 
 
19258
Pin1 WW domain
248
182
37
0
X
 
 
19257
Alpha-synuclein
114
245
114
0
X
 
 
19256
FimH -heptyl-mannose complex
802
622
171
0
X
 
 
19255
FimH Y48A mutant
189
0
171
0
X
 
 
19254
FimH Y48A mutant - Heptyl-mannose complex
188
0
170
0
X
 
 
19253
tau_K18
115
370
115
0
X
 
 
19252
RRM domain of HUMAN RBM7
506
298
80
0
X
 
 
19251
Nlh2
349
187
58
0
X
 
 
19250
LASSO PEPTIDE ASTEXIN3
131
0
0
0
X
 
 
19249
PAI subdomain of Sleeping Beauty transposase
274
0
54
0
X
 
 
19248
SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'
558
271
89
0
X
 
X
19247
plastocyanin
101
188
97
0
X
 
 
19246
GAP-43
889
703
219
0
X
 
 
19245
HisJ and Histidine
228
697
228
0
X
 
 
19244
Domain 2 from E. coli HisJ
94
290
94
0
X
 
 
19243
Domain 1 from E. coli HisJ
139
425
139
0
X
 
 
19242
apo-HisJ
229
697
229
0
X
 
 
19241
FKBP12
626
479
105
0
X
 
 
19240
FKBP12
627
479
105
0
X
 
 
19239
2c TCR
188
543
188
0
X
 
 
19238
Calmodulin_prototypical_calcium_sensor
523
440
143
0
X
 
 
19237
AhPDF1 from Arabidopsis halleri
306
128
30
0
X
 
 
19236
plastocyanin
94
195
94
0
X
 
 
19235
Aha1 dimer from Colwellia psychrerythraea
774
603
136
0
X
 
 
19234
MSP1-E28K
538
287
104
0
X
 
 
19233
msp1
556
382
108
0
X
 
 
19232
two-domain RNA-binding fragment of Nrd1
217
71
127
0
X
 
 
19231
PmrA
609
460
110
0
X
 
 
19230
Hdm2
531
147
121
0
X
 
 
19229
PHD Domain from Human SHPRH
409
285
68
0
X
 
 
19228
Pdx1
61
184
61
0
X
 
 
19227
Pdx1
50
161
50
0
X
 
 
19226
2'F-RNA/2'F-ANA chimeric duplex
0
0
0
0
 
 
 
19225
GM_CBM21
818
422
144
0
X
 
 
19224
PTP1B
286
553
286
0
X
 
 
19223
PTP1B
232
512
232
0
X
 
 
19222
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
0
0
0
88
 
X
 
19221
proteasome related subunit C terminal domain
998
785
187
0
X
 
 
19220
proteasome related subunit N terminal domain
879
670
170
0
X
 
 
19219
Yeast Rpn9
1818
1513
396
0
X
 
 
19218
Grx8
186
89
32
0
X
 
 
19217
SmTSP2EC2
494
274
82
0
X
 
 
19216
sod2 TM IV
143
0
35
0
X
 
 
19215
gp41-M-MAT
223
152
64
0
X
 
 
19214
Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain
676
547
145
0
X
 
 
19213
TePixJ
803
645
171
0
X
 
 
19212
rhodostomin 48ARGDWN-67NPWNG mutant
369
0
70
0
X
 
 
19211
rhodostomin 48ARGDWN-67NGLYG mutant
364
0
71
0
X
 
 
19210
rhodostomin P48A/M52W/P53N mutant
349
0
68
0
X
 
 
19209
HDHD4
210
654
210
0
X
 
 
19208
Arginine kinase transition state analogue complex
321
963
320
0
X
 
 
19207
HDHD4
201
610
201
0
X
 
 
19206
PcCBM36 monomer
679
544
131
0
X
 
 
19205
Engineered Cystine Knot Protein 2.5D
160
114
33
0
X
 
 
19204
BAF155 SWIRM domain
510
280
86
0
X
 
 
19203
RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1
511
281
87
0
X
 
 
19202
CONANTOKIN BK-B
35
23
0
0
X
 
 
19201
TAX1BP1 UBZ1+2
424
295
72
0
X
 
 
19200
LDLa
211
111
42
0
X
 
 
19198
SP18156A
391
233
70
0
X
 
 
19197
C-terminal structure of (Y81F)-EhCaBP1
303
266
68
0
X
 
 
19196
(Y81F)-EhCaBP1
271
248
60
0
X
 
 
19195
alfa-actinin from parasite Entamoeba histolytica
743
537
136
0
X
 
 
19194
20S-11S proteasome-activator complex
109
247
109
0
X
 
 
19193
(Y81F)-EhCaBP1
273
248
60
0
X
 
 
19192
beta-Hairpin Peptidomimetic Antibiotics
103
28
0
0
X
 
 
19191
eIF4E
338
262
60
0
X
 
 
19190
LptD
99
29
0
0
X
 
 
19189
hL-FABP
264
364
125
0
X
 
 
19188
hL-FABP:OLA
251
373
126
0
X
 
 
19187
Methanothermobacter thermautotrophicus MCM C-terminus
539
405
83
0
X
 
 
19186
S72-S107 peptide of 18.5 kDa MBP
70
114
34
0
X
 
 
19185
PilA
304
221
58
0
X
 
 
19184
calmodulin-binding domain of plant calcium-ATPase ACA2
174
0
0
0
X
 
 
19183
Trp-cage 16b P12W: a Hyperstable Miniprotein
113
0
0
0
X
 
 
19182
Aprataxin
150
334
150
0
X
 
 
19181
PorH
295
0
66
0
X
 
 
19180
Trp-cage Circular Permutant
112
0
0
0
X
 
 
19179
mol1
395
307
75
0
X
 
 
19178
MS1
388
300
85
0
X
 
 
19177
[Asp2,11]RTD-1
101
51
0
0
X
 
 
19176
[Asp11]RTD-1
101
51
0
0
X
 
 
19175
[Asp2]RTD-1
102
52
0
0
X
 
 
19174
Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1
47
91
47
0
X
 
 
19173
PTPN11 C-SH2 bound
675
504