Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Assigned Chemical Shift Entries

listed by accession number in descending order

Number of entries returned: 11644

Query grid description

Retrieve entries as a: Compressed file

Query result listed by accession number in descending order:

Accession number
System name
1H shifts
13C shifts
15N shifts
31P shifts
arenicin-3 derivative N2
arenicin-3 derivative N1
arenicin-3 derivative N6
relaxed pUb
retracted phosphorylated ubiquitin
Synaptotagmin-like protein 4
TAR DNA-binding protein 43
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Exoglucanase 1 (E.C.
Envelope small membrane protein
Mutator mutT protein (E.C.
analogue peptide VG13P
Putative uncharacterized protein
Eukaryotic translation initiation factor 3 subunit C
Human Gelsolin protein domain 1
Human Gelsolin protein domain 1
Tilapia Piscidin 4
Bradykinin-trypsin inhibitor secondary loop chimera
Bradykinin-trypsin inhibitor secondary loop chimera
DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')
Metabotropic GABA-B receptor subtype 1, Metabotropic GABA-B receptor subtype 3, isoform A
DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')
Defensin alpha-related sequence 1
Splicing factor 3B subunit 4
Uncharacterized protein
roseltide rT1
Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (E.C.
DP1, General transcription factor IIH subunit 1
Ubiquitin, putative
Small ubiquitin-related modifier 1
Small ubiquitin-related modifier 1
Small ubiquitin-related modifier 1
Switch-activating protein 1/DNA Complex
Small ubiquitin-related modifier 1
artificial quadruplex with propeller, diagonal, and lateral loop
Envelope Protein
DNA-binding protein
Receptor tyrosine-protein kinase erbB-2 (E.C.
Nucleolysin TIA-1 isoform p40
Breast cancer anti-estrogen resistance 1,Vinculin
Breast cancer anti-estrogen resistance 1,Tyrosine-protein phosphatase non-receptor type 12 (E.C.
Breast cancer anti-estrogen resistance 1
Protein NRD1
sh3b domain
MatB protein
MatA protein
Loquacious, isoform B
Ribosome hibernation promotion factor
Competence protein ComGC
RNA chaperone ProQ
RNA chaperone ProQ
Toll-like receptor 4
Dehydroascorbate reductase family protein
Protein (chimeric oligourea-peptide zinc finger)
Dehydroascorbate reductase family protein
RNA polymerase sigma factor SigA
DNA (26-MER)
Anti-sigma-F factor Fin
TAR DNA-binding protein 43
hnRNP A1 RRM2 in complex with 5'-UCAGUU-3' RNA
Peroxin 14
Putative metallothionein
Islet amyloid polypeptide
RNA-binding protein 5
RNA-binding protein 5, Survival motor neuron protein
Lipoprotein cytochrome c, 1 heme-binding site
Artificial quadruplex with propeller, diagonal and lateral loop
G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine
Protein PCF11
Regulator of Ty1 transposition protein 103, THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER
CUGBP Elav-like family member 2/RNA Complex
Variant surface glycoprotein MITAT 1.1
Curli production assembly/transport component CsgF
Gag protein
Decoration protein
Decoration protein
Bacteriocin BacSp222
Protein TonB
Adhesin protein
Regulator of Ty1 transposition protein 103, PRO-SER-TYR-SER-PRO-PTH-SER-PRO-SER-TYR-SER-PRO-THR-SER-PRO-SER
Epidermal growth factor receptor (E.C.
RNA (29-MER)
Beta-nerve growth factor
Non-specific lipid-transfer protein 2
Peroxisomal biogenesis factor 19
Matrix protein p10
Neural cell adhesion molecule 1
Fusion protein 5.5/5.7
Uncharacterized protein
Amyloid beta A4 protein
Lactococcin-A immunity protein
myristoylated M-PMV matrix protein mutant
BolA-like protein 1
Bacteriochlorophyll c-binding protein
Small toxic polypeptide LdrD
Inner membrane protein YgaP
Inner membrane protein YgaP
tau-AnmTx Ueq 12-1
Zinc finger HIT domain-containing protein 3, Nuclear fragile X mental retardation-interacting protein 1
Enterococcin K1
C-X-C motif chemokine 13
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1
Major prion protein
Insulin-like growth factor II
Insulin-like growth factor II
Insulin-like growth factor II
Talin-1, Ras-related protein Rap-1b
Tyrosine-protein kinase ABL1 (E.C.
Tyrosine-protein kinase ABL1 (E.C.
38-mer peptide
ShK homolog AsK132958
Troponin C, slow skeletal and cardiac muscles, Troponin I, cardiac muscle
Stress Response Peptide-2
RNA-binding protein FUS
Cytoplasmic Tail of HIV-1 gp41 protein
Yeast dnaJ protein 1
Troponin C, slow skeletal and cardiac muscles,Troponin I, cardiac muscle
human Tsg101 UEV in complex with tenatoprazole
Adhesion invasion locus
Annexin A1
Polyubiquitin-B, E3 ubiquitin-protein ligase RAD18 (E.C.
Histone H2A, Polyubiquitin-B, E3 ubiquitin-protein ligase RNF169 (E.C.
M protein
M protein
20-mer Peptide
RNA (41-MER)
RNA (41-MER)
14-mer Peptide/RNA Complex
Papain-like proteinase (E.C.,
UPF0297 protein EF_1202
Heterogeneous-backbone Foldamer Mimic of the Sp1-3 Zinc Finger
RNA polymerase II transcription factor B subunit 1, Transcription factor p65
Uncharacterized protein
Alpha-conotoxin GID
Alpha-conotoxin GID
phage GA operator RNA hairpin
Immunoglobulin G-binding protein G
Immunoglobulin G-binding protein G
Immunoglobulin G-binding protein G
Immunoglobulin G-binding protein G
Muscleblind-like protein 1/RNA Complex
Preproalbumin PawS1
Muscleblind-like protein 1
Muscleblind-like protein 1
Bromodomain-containing protein 2, Stat3 peptide
HMWP2 nonribosomal peptide synthetase
Cyclic tetrapeptide ALA-ARG-ALA-UN1
Nucleoporin POM152
Degenerin mec-4
Siderophore yersiniabactin
E3 ubiquitin-protein ligase parkin (E.C.6.3.2.-)
Calmodulin, Nitric oxide synthase, inducible (E.C.
HTH-type transcriptional regulator SinR
HTH-type transcriptional regulator SinR
Protein SinI
DNA Dodecamer with 5-methylcytosine
Thiol:disulfide interchange protein DsbA
Beta/omega-theraphotoxin-Tp2a analog
Dihydroorotate dehydrogenase (quinone), mitochondrial (E.C.
PHD finger protein 20, Histone H3.1
Cytotoxin 1
Reverse transcriptase
Toll/interleukin-1 receptor domain-containing adapter protein
Chi-conotoxin-like PnMRCL-013
Chi-conotoxin-like PnMRCL-013
Microcin J25
Envelope glycoprotein
Two-component system response regulator
Phosphocarrier protein NPr (E.C.2.7.11.-), Phosphoenolpyruvate-protein phosphotransferase PtsP (E.C.
Phosphocarrier protein NPr (E.C.2.7.11.-)
Phosphocarrier protein NPr (E.C.2.7.11.-)
Calmodulin, Estrogen receptor peptide
ELAV-like protein 1
Uncharacterized protein aq_1974
Bifunctional coenzyme PQQ synthesis protein C/D (E.C.
Bcl-2-like protein 1
Neurogenic locus notch homolog protein 1
Designed peptide NC_cEE_D1
Designed peptide NC_cHHH_D1
Designed peptide NC_cHh_DL_D1
Designed peptide NC_cHH_D1
Designed peptide NC_EEH_D1
Designed peptide NC_EEH_D2
Designed peptide NC_EHE_D1
Zoocin A endopeptidase
Designed peptide NC_HEE_D1
Scavenger receptor class B member 1
Flagellar protein FliT
Eukaryotic elongation factor 2 kinase (E.C.
Flagellar protein FliT,Flagellar hook-associated protein 2
2''-aminoglycoside nucleotidyltransferase (E.C.
Telomerase RNA P2ab
Peptidase M23 (E.C.
Peptidase M23 (E.C.
De novo Beta Sheet Design Protein OR485
De novo Beta Sheet Design Protein OR664
Flagellar protein FliT,Flagellum-specific ATP synthase (E.C.
La-related protein 7
O2_contryphan_Vc1 prepropeptide
Gap junction beta-1 protein
Beta-amyloid protein 42
Gap junction beta-2 protein
Gap junction beta-2 protein
Endothelial PAS domain-containing protein 1
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')
DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')
Antimicrobial peptide KAMP-19
PSM Alpha1
riboswitch (47-MER)
Phenol-soluble modulin Beta2
Phenol-soluble modulin Alpha 3
DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')
DNA damage-inducible protein 1
Myosin-binding protein C, cardiac-type
Islet amyloid polypeptide, HI18
Helicase-like transcription factor (E.C.3.6.4.-,6.3.2.-)
Protein DDI1 homolog 2
Coat protein
Two-component sensor histidine kinase, Circadian clock protein KaiB
Two-component sensor histidine kinase
Circadian clock protein KaiB
Envelope glycoprotein gp160
Immunoglobulin G-binding protein G
Protein-lysine N-methyltransferase (E.C.2.1.1.-)
Protein-export protein SecB, Maltose-binding periplasmic protein
Protein-export protein SecB, Maltose-binding periplasmic protein
Protein-export protein SecB, Alkaline phosphatase (E.C.
Protein-export protein SecB, Alkaline phosphatase (E.C.
Protein-export protein SecB, Alkaline phosphatase (E.C.
Protein-export protein SecB, Alkaline phosphatase (E.C.
Protein-export protein SecB, Alkaline phosphatase (E.C.
Uncharacterized protein
Guanine nucleotide-binding protein G(i) subunit alpha-1
Guanine nucleotide-binding protein G(i) subunit alpha-1
Sodium channel protein type 4 subunit alpha
E3 ubiquitin-protein ligase TRIM21 (E.C.6.3.2.-)
Dynein light chain Tctex-type 1
Uncharacterized protein
Uncharacterized protein
Antivirulence protein AVR-Pia
Putative peptidyl carrier protein
Voltage-dependent anion-selective channel protein 1
Choline binding protein (E.C.
Calmodulin, Eukaryotic elongation factor 2 kinase (E.C.
Calmodulin, Disks large homolog 4
Fibronectin, Anastellin
DNA (25-MER)
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
Serine/threonine-protein kinase B-raf (E.C.
Cyclic peptide mimetic of Tat/RNA Complex
Serine/threonine-protein kinase B-raf (E.C.
Serine/threonine-protein kinase B-raf (E.C.
Cyclic peptide mimetic of HIV-1 Tat/RNA Complex
DNA Dodecamer with 8-oxoguanine at 10th Position
C-X-C motif chemokine 13
Antifreeze protein
Antibacterial factor-related peptide 2
Capsid protein p24
Uncharacterized protein
Zinc finger and BTB domain-containing protein 17
E3 ubiquitin-protein ligase Midline-1 (E.C.6.3.2.-)
CDC48-associated ubiquitin-like/zinc finger protein 1
General control protein GCN4
General control protein GCN4
General control protein GCN4
5'-terminal hairpin of the 7SK snRNA
Sensory transduction regulatory protein
Mitochondrial Calcium Uniporter
beta-galactosidase 1
E3 ubiquitin-protein ligase UHRF1 (E.C.6.3.2.-), Spacer
Protein S100-A9
W7A mu-TRTX-Pre1a Toxin
Myc box-dependent-interacting protein 1, CHIKV nsP3 peptide
mu-TRTX-Pre1a toxin
Nucleocapsid protein p7
Type I modular polyketide synthase
Type I modular polyketide synthase
Protein phosphatase 1 regulatory subunit 12A
CREB-binding protein,Cellular tumor antigen p53 (E.C.
CREB-binding protein,Cellular tumor antigen p53 (E.C.
Cellular tumor antigen p53,CREB-binding protein (E.C.
N15alphabetaTCR, pTalpha/N15beta
N15alphabetaTCR, pTalpha/N15beta
N30alphabetaTCR, pTalpha/N30beta
N15alphabetaTCR, pTalpha/N15beta
Jun monomer
human Cyclophilin A
Trigger factor
ROR1 Kringle monomer
Trigger factor
hTE-CCR monomer
CAMSAP3 CKK domain
subunit c ring of FoF1 ATP synthase
full length Dengue NS4A
single polypeptide chain, RSK1 phosphorylated C-terminal peptide (696-735)
single polypeptide chain, RSK1 C-terminal peptide (696-735)
fibrils Abeta(1-42)
Fc fragment of mouse immunoglobulin G
PB6 full length
ProXp-ala bound to microhelixPro
P1 domain of CheA
EIC dimer
Coronavirus nsp1 truncated proteins; nsp1(13-50)
Coronavirus nsp1 truncated proteins; nsp1(13-25)
KRAS promoter region
Polypeptide chain
solubility domain GB1
LisH dimer
Fyn SH3SH2 monomer
CHIKV macro domain
chromatin-associated protein swi6
PupB-NTSD monomer
Brr2 C-terminal Sec63 unit
C-terminal domain of MSP2
XPA98-239 monomer
RbmA FnIII-2 domain
hL-FABP apo
TopN monomer
SH2B1/JAK2-pep complex
hnRNPA2 LC D290V disordered monomer
hnRNPA2 LC disordered monomer
Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)
Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)
SH2B1 SH2 Domain
NOX1 ativator
gp17.1 phage tail
mth10btqqa homodimer
mvo10b homodimer
CaM NaV1.2 IQ motif
CaMC NaV1.2 IQ motif
Elongation factor P
ISCU monomer
ISCU monomer
single polypeptide chain
NS5Bd21 monomer
MAK33 VL amyloid fibril
CTD27-52 monomer
KRAS oncogene promoter region
Hamster PrP 90-231
cHSP27 dimer
HttExon1 fibrils
Sgt2_TPR monomer
PipX monomer
Bet v 1.0102
P23T HGD aggregated at pH 7
prr7 dissordered protein
Ube2T (1-154)
TvCyP2 monomer
CzrA homodimer
Ascl1 trascription factor
Ascl1 trascription factor
Ascl1 trascription factor
Ascl1 trascription factor
human betaB2-crystallin dimer
Gladiolin binding domain monomer
c-NmDsbD monomer
c-NmDsbD monomer
n-NmDsbD monomer
n-NmDsbD monomer
human 4E-BP1 (fragment 44 to 87)
Rabbit Prp 90-231
human 4E-BP1 (fragment 44 to 87) bound to mouse eIF4E
Regulatory domain of Calcineurin
tmRNA-binding protein
Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein
Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein
Wild type fused Npu DnaE from Nostoc punctiforme with Gly +2 Extein
Wild type fused Npu DnaE from Nostoc punctiforme with Phe +2 Extein
Beta-chain labeled B4.2.3 TCR
G alpha i3 bound to GoLoco14
G alphai 3 bound to GDP
Hsp31 dimer
SET domain of human methyltransferase NSD3
SUMO-specific protease 4 (SUSP4 201-300)
CzrA homodimer
Prion monomer
Ca-S100A4d9-C-ERMAD complex
Fyn SH3 V39V/N53P/V55L delta56
KLF4 1-130
USP7 catalytic domain
AIPL1 FKBP/FC complex
Human SMAD4 MH1 domain
LITAF delta114-139
nanobody 39
nanobody 33
NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine aldehyde
MTTTm monomer
NS2B-NS3 Protease from Zika Virus
NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine
ShaPrP23-144 amyloid fibrils
huPrP23-144 amyloid fibrils
mouse PrP23-144 amyloid fibril
First RRM domain of MEC-8
Cx37CT Domain
y21m protein coat monomer
E coli DNA polymerase III delta subunit (residues 1-140)
hydrophobin from Phanerochaete carnosa
monomeric SOD1
monomeric SOD1
bound chains A and B
HBHA and Heparin
ferrous THB1
Ferric THB1
virus-like particles
LC3B monomer
AL-09 VL fibrils
VcPth-N118D mutant
VcPth-N72D mutant
VcPth-N14D mutant
VcPth-H24N mutant
NS2B-NS3 Protease from Zika Virus
Dpo4 Binary
HADDOCK model of the complex between the KIX domain of CBP and the transactivation domain of p65
PDZ domain
Stress Response Peptide-2
Lipoprotein signal peptide with globomycin
VirB8 homodimer
COMT monomer, Sinefungin, DNC, Mg
COMT monomer, SAM, DNC, Mg
Protein Tyrosine Phosphatase 1B N193A variant in complex with TCS401
NCP15 + Zncl2
GacSperi monomer
Protein Tyrosine Phosphatase 1B (1-301) in complex with TCS401
Protein Tyrosine Phosphatase 1B N193A variant
Protein Tyrosine Phosphatase 1B L192A variant
Protein Phosphatase 1B T178A variant
alpha-N Catenin C-terminal domain
Protein Tyrosine Phosphatase 1B YAYA (Y152A, Y153A) variant
M337P TDP-43_267-414 Monomer
M337V TDP-43_267-414 Monomer
Q331K TDP-43_267-414 Monomer
A326P TDP-43_267-414 Monomer
A321V TDP-43_267-414 Monomer
A321G TDP-43_267-414 Monomer
Lunasin monomer
Lunasin monomer
WT TDP-43_267-414 Monomer
a1I_E317A monomer
Lunasin monomer 16-43
Protein Tyrosine Phosphatase 1B residues 1-284
Npm Tail Monomer
Egr-1 DNA complex
The Egr-1 zinc-finger protein
human aquaporin 1
CEACAM1-Igv homodimer
Cold Shock Protein A
VapC family toxin
USP7 - ICP0 complex
Cdc25B monomer
ribosomal protein S1
C. elegans TDP2 Ubiquitin Association domain
CP12 reduced
STARD6-testosterone complex
NSD2 C16
p38 gamma
PHD domain of human BAZ2A
MycG-MIV complex
Met-1 Human Ang
GNAI1 monomer
SrtC1 monomer
EeCentrocin 1
human Ca2+-bound mS100A9 (C3S) homodimer
p38g monomer
p38g monomer
Paired domain of Pax5 in complex with DNA
Paired domain of Pax5
C-terminal domain of TDP-43
Doublecortin C-terminal domain monomer
Extracellular Adherence Protein
Domain Swapped HIV RNase H
linear diubiquitin
SAMSAM monomer
Sam68 STAR
rNedd4 WW3 Domain
CSE4 (CENP-A) protein
Amyloid Beta fibril
protein + bound peptide
Mg2+ -bound myrGCAP1 (V77E) mutant
FUS LC monomer
SczA homodimer
MERS-CoV macro domain
Full-length HIV-1 Transactivator of Transcription
emerin 67-170
emerin 67-170
Akt_PHD in complex with Calmodulin
IF1 monomer
p65 DBD
mini H2-Ld
single polypeptide chain
N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit
Envoplakin PRD
MurD monomer
alpha B crystallin
apolipophorin III
dengue virus NS4B N-terminal 125 amino acids
human K-Ras4B-GDP
protein alone
Protein G Domain Beta-1 Sequence H
Protein G Domain Beta-1 Wild-Type
HuR RRM1-2
ASAP1 PH domain
integrin beta1 TM/CT
integrin beta3 TM/CT
Barnase monomer
NaK tetramer
SUR2A NBD1-MgATP complex
active domains of the type II topoisomerases
active domains of the type II topoisomerases
active domains of the type II topoisomerases
active domains of the type II topoisomerases
ubiquitin (microcrystal)
Microtubule-associated protein light chain 3C (LC3C)
D10alphabetaTCR, pTalpha/D10beta
N30alphabetaTCR, pTalpha/N30beta
N15alphabetaTCR, pTalpha/N15beta
THAP11 coiled-coil dimer
DNA gyrase B subunit
DNA gyrase B
hTRF1-DnaK complex
hTRF1 monomer
Obscurin Ig59
ROQ-SELEX consensus hexa-loop RNA
ROQ-Ox40hexa-loop RNA
Cyanobacterialchrome GAF domain
nuclear egress subunit M50 from murine cytomegalovirus
cytochrome c
Cyanobacteriochrome GAF6012g4
SOD1 monomer
TCR 3c8m t55a, TCR alpha
The structure of the SOLE element of oskar mRNA
Notch1 transmembrane segement
DbhS C31S monomer
major mite allergen Der p 23
Solution Structure of the Smarc Domain
PfIMP1 monomer
p73 DNA binding domain
Prostate associated gene 4 phosphorylated
Prostate associated gene 4
Short hydrophobic peptide, 11mer, SS
Short hydrophobic peptide, 11mer
Short hydrophobic peptide, 11mer
PmrA-DNA complex
FtsXECL1 monomer
PmrA dimer
WHB in complex with UBCH10
UBCH10 in complex with WHB
putative transfer protein TraH from Gram-positive conjugative plasmid pIP501
HPV 16 E7 CR3
DNA-binding HU protein
PawS Derived Peptide 20 (PDP-20)
PawS Derived Peptide 21 (PDP-21)
PawS Derived Peptide 22 (PDP-22)
dermcidin peptide DCD-1L
toxin ISTX-I from Ixodes scapularis
AF9 yeats domain in complex with histone H3 crotonylation at K18
AF9 yeats domain in complex with histon H3 acetylation at K18
d58CI dimer
Mutant of BMAP-28(1-18)
omega-agatoxin IVA
H-NOX Monomer
Lysine dimethylated FKBP12
BRD4 ET domain with NSD3_3 peptide
BRD4 ET with NSD3_1
pseudin-2 analog (Ps-P)
RWS21 in LPS micelles
KYE21 in LPS
membrane proximal external region of HIV-1 gp41 in hexafluoroisopropanol
membrane proximal external region of HIV-1 gp41 in DPC micelles
r(CGG) motif
r(CGG) motif
BOLA3 from Homo sapiens
Protein kinase G (PknG) 74-147 rubredoxin domain reduced, metal bound form
Protein kinase G (PknG) 74-147 rubredoxin domain oxidized, metal free form
Protein kinase G (PknG) 1-147 natively disordered region + rubredoxin domain reduced, metal bound form
Protein kinase G (PknG) 1-75 natively disordered region
PriC DNA replication restart protein
Q4DY78 monomer
RNA (28-MER)
translation initiation factor IF1
Sr33 Coiled-coil domain
Ca2+-bound C2 domain in complex with V5-pHM peptide
N-terminal Domain of Human Cdc37
Hop TPR2A monomer
Mycobacterium tuberculosis LppM (Rv2171) protein folded domain
Antimicrobial peptide protegrin PG-5
N-L-idosylated Pin1 WW Domain
N-Xylosylated Pin1 WW Domain
N-Galactosylated Pin1 WW Domain
N-Allosylated Pin1 WW Domain
antifungal protein sfPAFB
delta-J-delta-K domain of EMCV IRES
St domain of EMCV IRES
K domain of EMCV IRES
J domain of EMCV IRES
J-K region of EMCV IRES
human Rpn13 Pru domain
designed protein E_1r26
Human gammaC-crystallin
E1A-12S monomer
PHD domain of human BAZ2B
palmitated SCP2L2
Peptide model of 4-stranded beta-arch
ADRM1-RPN2 complex
fungal hydrophobin
Geobacillus stearothermophilus IF2 G3-subdomain
calcium-bound form of Penicillium antifungal protein (PAF)
V26A mutant of Ubiquitin at pH 2.0
V26A mutant of Ubiquitin at pH 6.0
poneritoxin, omega-PONTX-Ae1a
Acidic domain of SYNCRIP (24-140)
minor DNA-uptake pilin ComP
Mal d 1.0101
ZitP zinc finger
C-terminal extramembrane domain of SH protein
N-terminal extramembrane domain of SH protein
Structure of human islet amyloid polypeptide in complex with an engineered binding protein
Q388A3 PDZ domain
p63/p73 hetero-tetramerisation domain
D19S variant of the Penicillium Antifungal Protein (PAF)
Solution structure of oxidised and zinc-bound RsrA
Solution structure of reduced and zinc-bound RsrA
Bt1.8 peptide
CCHC zinc finger domain of Pcf11
KYE28A in lipopolysachharide
KYE28 and lipopolysachharide
AVR3a_60-147 from Phytophthora infestans
Full-length WT SOD1
K2 lobe of double-knot toxin
Membrane-bound mouse CD28 cytoplasmic tail
Nizp1-C2HR zinc finger
NSD1-PHD_5-C5HCH tandem domain
P441A Mutant of the Cytokine Receptor Common Subunit beta
Cytokine Receptor Common Subunit beta
Transmembrane domain of human Fas/CD95 death receptor
Transmembrane domain of mouse Fas/CD95 death receptor
vitamin B12 conjugate of PYY3-36
Curli secretion specificity factor CsgE W48A/F79A mutant
rv3053c from Mycobacterium tuberculosis in the oxidized state
Drosha Quad
BMI1-PHC2 complex
Integrin alphaIIb-beta3(A711P) Transmembrane Complex
LC3 FUNDC1 complex
Erythrobacter litoralis PhyR response regulator REC domain
Photoswitchable G-quadruplex
RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain
RNF126 N-terminal zinc finger domain
in-cell GB1
in vitro GB1
oxidized human cytochrome c
reduced human cytochrome c
Glucose as a nuclease mimic in DNA
bromodomain of Trypanosoma brucei Bromodomain Factor 2(BDF2)
DERA mutant (K58E-Y96W)
Glucose in a DNA double helix
actinin-1 EF bound to IQ
SUMO-2 bound to phosphorylated RAP80 SIM
NRAS Isoform 5
Holo F2 TnC
Apo F2 TnC
DNA free
F1F2 free
F1F2-DNA complex
SLURP-2, a secreted isoform of Lynx1
acyl carrier protein LipD
DD homodimer
dsDNA-lomaiviticin A complex
yeast Hit1 protein zinc finger
N-terminus F2 TnC
C-terminus F2 TnC
N-terminus F2 TnC
cecropin P1 with LPS
C-terminus F2 TnC
L6F polypeptide
RSK1 peptide
TrkA transmembrane domain
Apo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
Holo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1
PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES
rNedd4 WW2 Domain
rNedd4 WW2 Domain-Cx43CT Peptide Complex
rNedd4 WW1 Domain
ACT RTX domain
complex between MMP-12 and synthetic triple-helical collagen
Lacticin Q
Aureocin A53
translation initiation factor from Staphylococcus aureus Mu50
Zipcode-binding-protein-1 KH3(DD)KH4 domains in complex with the RNA target UCGGACU
Zipcode-binding-protein-1 KH3KH4(DD) domains in complex with the RNA target CACACCC
spider toxin, U33-theraphotoxin-Cg1c
TRIM24 PHD-Bromo
spider toxin pi-hexatoxin-Hi1a
cyclic PVIIA
In silico designed antimicrobial peptide Lavracin
Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC
A3CT monomer
chromodomain 3 (CD3) of cpSRP43
OtTx1a - ICK
OtTx1a - AMP in DPC micelles
FHA domain of TbPar42
complex of microRNA 20b pre-element with Rbfox RRM
Lipid Transfer Protein From Pea Pisum Sativum
metal-binding domain 1 of ATP7B
microRNA 20b pre-element
UBL protein
Peptide PG-990
Leptospiral LigA4 Big Domain
transmembrane domain of human nicastrin in DPC micelles
transmembrane domain of human nicastrin in SDS micelles
PDZ domain
Peptide PG-990 in DPC micelles
Peptide PG-989
core of the U4/U6 di-snRNA
N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9
KIAA0323 binding with NEDD8
B3 domain of protein G
prolactin receptor transmembrane domain
cyclic nucleotide-binding homology domain of hERG channel
muO-conotoxin MfVIA
UBL domain of the yeast DNA damage-inducible protein homolog 1
UBL domain of the human DNA damage-inducible protein homolog 2
Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNA
human I-type lectin domain-glycan complex
human Siglec-8
cardiac troponin C
complex of PEP-19 bound to the C-domain of apo calmodulin
RNA-Binding domain of non-structural protein 1 from the 1918 H1N1 influenza virus
kinase in complex with its regulatory protein
polyQ regulatory protein
CmPI-II, a serin protease inhibitor
Influenza-A M2
salicylate-loaded ArCP from yersiniabactin synthetase
holo ArCP from yersiniabactin synthetase
CssA5 (middle region) of CssA thermometer
CssA Thermometer from Neisseria meningitidis
Lasso peptide Astexin2-dC4
CssA3 (top stem) of CssA thermometer
CssA4 (bottom stem) of CssA thermometer
spider toxin U4-hexatoxin-Hi1a
Tetrahymena telomerase RNA pseudoknot
Outer Membrane Protein G P92A mutant
spider-venom peptide Hm1a
spider toxin, U4-agatoxin-Ao1a
frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]
Outer Membrane Protein G from Pseudomonas aeruginosa
Vta1NTD-Did2(176-204) complex
2-stranded parallel beta-sheet
2-stranded parallel beta-sheet
MbtH-like protein from Mycobacterium avium
Quercetin complexed with c-myc G-quadruplex DNA
de-novo toxin Hui1
Src catalytic domain
non-sweet mutant (ins18RI19) of sweet protein Brazzein
LASSO peptide Astexin1
sweeter mutant (D40K) of sweet protein Brazzein
CIN85 CC-domain trimer
DNA G-quadruplex
N-terminal domain of the metalloprotease PrtV from Vibrio cholerae
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
octyl-tridecaptin A1 in DPC micelles containing Gram-negative lipid II
C-terminal domain of Cdc37 cochaperone
octyl-tridecaptin A1
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
The selective autophagy receptor TAX1BP1 is required for autophagy-dependent capture of cytosolic Salmonella typhimurium
TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy
phosphoenolpyruvate-Enzyme I complex from the bacterial hosphotransferase system
H-Ras G12V
EGFR transmembrane and juxtamembrane domains
HBPd24r bound to histamine
R4 peptide
cystein-rich peptide jS1
Control DNA oligonucleotide for the universal base
Universal Base oligonucleotide with UB at point 5
KIAA0323 binding preference for NEDD8
Regnase-1 C-terminal domain
Regnase-1 Zinc finger domain
Regnase-1 N-terminal domain
pyoluteorin type II pep-tidyl carrier protein PltL, holo form
dehydroascorbate reductase 3A from Populus trichocarpa
high-density lipoprotein particles
Ub S65E in complex with parkin R0RBR
Ub S65E
Ub in complex with parkin R0RBR
VirA VirFG fusion
lasso peptide chaxapeptin
oxidized form of thioredoxin 1 from Sacharomyces cerevisiae
reduced form of thioredoxin 1 from Sacharomyces cerevisiae
R. palustris CsgH
N-terminal membrane-anchoring region of the glycosyltransferase WaaG
hCFTR NBD1 deltaRI F508del
hCFTR NBD1 deltaRI I539T
hCFTR NBD1 deltaRI
kallikrein inhibitor SPINK6
eukaryotic elongation factor 1B monomer
Acyl Carrier Protein monomer
G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
Transmembrane Electron Transporter CcdA
CBX8 in complex with AF9
MALT1 subunit 1
3-stranded parallel beta-sheet
N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct
HIV ISS element
Enterocin HF
self complementary Xylonucleic Acid duplex
Q343R Mutant of TDP-43 Amyloidogenic Core Region
G335D Mutant of TDP-43 Amyloidogenic Core Region
NESG Target OR34
rna-ligand complex
Y48pCMF variant of human cytochrome c in its reduced state
TDP-43 Amyloidogenic Core Region
Proteasome protein fragment
Translation initiation factor IF-1 from Burkholderia thailandensis E264
II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUM
II-III-VI three-way junction from the VS ribozyme
PTBRRM1-SL23H complex
active G-quadruplex motif from AGRO100
RNA recognition motif-1 of serine/arginine-rich protein 1
Human Brd4 ET domain in complex with MLV Integrase C-term
Amino-terminal domain of Latrodectus hesperus MaSp1 with neutralized acidic cluster
cytoskeletal bactofilin BacA
LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)
C-terminal domain of the chromodomain helicase DNA-binding protein 1
AVR-Pia monomer
ABD monomer
nonspecific lipid transport protein from the dill Anethum graveolens L.
meiosis-expressed gene 1 (Meig1)
G88A,D90R double mutant of KaiB
G89A,D91R double mutant of KaiB bound to CI
G89A,D91R double mutant of KaiB
G89A,D91R double mutant of dimeric KaiB
D91R single mutant of dimeric KaiB (thioredoxin-like fold)
D91R single mutant of dimeric KaiB
G89A single mutant of dimeric KaiB
N-SasA bound to CI
dimeric KaiB bound to CI
KaiB dimer
insulin analogue
insulin analogue
[B26-B29 triazole cross-linked]-insulin analogue
pheromone Ep-1 from Euplotes petzi
double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA
murine tumour necrosis factor alpha CDE RNA
closed state of Lys63-linked diubiquitin
LigA4 Big domain
Sds3 in complex with Sin3A
Dynorphin 1-13 bound to Kappa Opioid Receptor
TDP-43 prion-like hydrophobic helix in DPC
HER2/ErbB2 dimeric transmembrane domain
Vpu cytoplasmic domain
Vpu from HIV-1
Fag s 1
High-affinity calmodulin complexes with vanilloid ligands of TRPV1
Miz-1 zinc fingers 2 to 4
wt NS4A N-terminal domain of DENV
complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)
Complex between the Transactivation Domain of p65 and p62/Tfb1 subunit of TFIIH
Protein and DNA complex
human SUMO2
human SUMO1
SAP30L corepressor protein
Antimicrobial Peptide SmAMP2-2c
Myristylated Feline Immunodeficiency Virus Matrix Protein
HIV-1 Core Packaging Signal
PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide
Third Type III Domain from Human Fibronectin
PR domain from PRDM16
C-terminal domain of human polymerase Rev1 in complex with PolD3 RIR-motif
MAX1 peptide fibril
MRG15-MRGBP complex
nucleotide-free Ran GTPase
SUMO1 and ZZ-domain from CBP
PLK4-PB3 monomer
Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome c
MyUb (1080-1122) of human Myosin VI with K63-diUb
human Myosin VI isoform3 (1050-1131)
human Myosin VI isoform3 (998-1071)
MyUb (1080-1131) of human Myosin VI
MyUb (1080-1122) of human Myosin VI
NSsCT-Tfb1PH complex
EPI-X4, a human albumin-derived peptide
alpha-synuclein fibrils
Ca-bound hN-1 8-11
N2-dG IQ at G1 in NarI sequence
hylin a1
DNA Dodecamer with 8-oxoguanine at 4th Position
alpha-crystallin domain from human, HSPB5
Neuromedin C in presence of SDS micelles
Neuromedin C in 90% TFE
Neuromedin C in 60% TFE
Neuromedin C in 40% TFE
Neuromedin C in 25% TFE
Neuromedin C in 10% TFE
Neuromedin C in water
Short hydrophobic peptide, 11mer
Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1
non-phosphorylated J-domain of Human Cysteine String Protein (CSP)
phosphorylated J-domain of Human Cysteine String Protein (CSP)
TSPO A147T variant in complex with PK11195
VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS
cChimeraX-A162H, Ca2+ bound
AIM2 PYD from Mus musculus
APOBEC3G NTD variant, sNTD
Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b
CCR5-ECL2 helical structure, residues Q186-T195
Staphylococcus aureus FusB:EF-GC3 complex
Peptidyl-prolyl cis-trans isomerase A
SH2-SH3 adapter protein drk
SH2-SH3 adapter protein drk
RRM3 domain of Hrb1
RRM2 domain of Hrb1
RRM1 domain of Hrb1
RRM3 domain of Gbp2
First and Second KH domains of hnRNP E1
Human Med26 N-Terminal Domain (1-92)
Conantokin Rl-B
Conantokin Rl-B
PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane
PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane
Purotoxin-2 in DPC micelles
Purotoxin-2 in water
PRO Form of Human Matrilysin (proMMP-7)
p300 Taz2-p53 TAD2 Complex
Metal Binding of Glutaredoxins
GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)
perforin C2 quad mutant
oxidized triheme cytochrome PpcA
Tau(267-312) bound to Microtubules
Protegrin-3 (PG3)
hnRNP C RRM in complex with 5'-UUUUC-3' RNA
MbtH-like protein from Mycobacterium marinum
NS1B ED dimer
NS1B ED mutant monomer
CUE domain of yeast Cue1
Fungus protein B9WZW9_MAGOR
Fungus protein Q8J180_MAGGR
Odin-Sam1 fragment
Cullin3 - BTB interface
Cullin3 - BTB interface
cytochrome OmcF
bacterial chaperone
Human galectin-8
Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium Channels
dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei
RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum
N-terminal domain of human TIG3
KstB-PCP (holo)
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)
Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255
Bud31p protein
Bud31p protein
Endo T5-ZN+2
hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA
Amylase binding Protein A
GADD34 PP1 complex
42-Residue Beta Amyloid Fibril
acidic domain of SYNCRIP (hnRNPQ)
transforming growth factor beta induced protein (TGFBIp)
DEFA1, a highly potent antimicrobial peptide from the horse
NDP52 ubiquitin-binding zinc finger
human Cyt c G41S mutant (ferric)
G7W/N24S Hhn2b
human Cyt c G41S mutant (ferrous)
TRTX-Tp1a from the tarantula Thrixopelma pruriens
human Cyt c
RNA (39-MER), 3' splice site in influenza A: 39-nt hairpin
3' splice site influenza A: 19-nt duplex
3' splice site influenza A: 11-nt hairpin
Sigma-1 receptor delta 35 construct
VG16KRKP, an antimicrobial peptide in SDS
VG16KRKP, an antimicrobial peptide in D8PG micelles
DNA complex of the C-Terminal domain of MvaT
C-terminal domain of MvaT
VPg of porcine sapovirus
Clathrin Heavy Chain
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 5.5
N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 7.2
mouse EpoR
internal EH domain of gamma-synergin
complex of Dvl PDZ domain with ligand
IST1 peptide
tumor protein monomer
zinc finger domain
Ssa1 substrate binding domain
BecN-150CSY monomer
human TRAP1-NTD
UBX-L domain of VCIP135
E. coli threonylcarbamoyl-AMP synthase TsaC
HP0268 from Helicobacter pylori
A G-quadruplex structure
RING Domain of human Promyelocytic Leukemia Protein (PML)
PTP1B CPT-157633 Complex
DNA Dodecamer with 8-oxoguanine at 10th Position
crotalicidin in DPC micelles
Y171W mutant of Adenylate Kinase in complex with Ap5a for state b
Y171W mutant of Adenylate Kinase in complex with Ap5a for state a
P177A mutant of Adenylate Kinase in complex with Ap5a
periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor
Adenylate Kinase Y171W
TPMT *1 16-245
EphB2 kinase domain
Abp1p SH3 domain
Acidocin B
PsbQ from spinacia oleracea
53BP1 tandem Tudor domains in complex with a p53K382me2 peptide
53BP1 tandem Tudor domains in complex with a p53K370me2 peptide
MG200 EAGRbox
CaM Tr2C, monomer
Talin-F3 / RIAM N-terminal Peptide complex
NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN
VG16KRKP, an antimicrobial peptide in LPS
Type 1 Pilus
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1, Ser3, and Ser14
Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1 and Ser3
carboxy-terminal domain of DNTTIP1
Protein Hybrid Beta-Synuclien HC
ligand-free OAA
FBP28 WW2 mutant Y438R DN
FBP28 WW2 mutant Y438R L453A DNDC
FBP28 WW2 mutant Y438R DNDC
FBP28 WW2 mutant W457F
FBP28 WW2 mutant Y446L
FBP28 WW2 , mutation Y438R
obscurin Ig58
SATB1 homeodomain
OAA monomer
titin M10
obscurin Ig1 bound to titin M10
titin M10-obscurin-Ig1
Monomer of Mo3964
bee venom toxin melittin with [(C5H5)Ru]+ fragment attached to the tryptophan residue
Human Small Ubiquitin like Modifier protein-1 (SUMO-1)
Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein
lasso peptide streptomonomicin
Hha-H-NS46 charge zipper complex
NP_809137.1 monomer
Kalata B7 Ser mutant
RNA duplex
ASR trimer
amyloid-beta fibrils: the Osaka mutation
TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)
5-phenyl-3-oxo-pentyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor
3,7-dioxo-octyl Actinorhodin Acyl Carrier Protein
scoloptoxin SSD609 from Scolopendra mutilans
mouse BMAL1 transactivation domain
lantibiotic self-resistance lipoprotein MlbQ from Microbispora ATCC PTA-5024
eEF1Bdelta CAR domain in TCTP-bound state
eEF1Bdelta CAR domain
cytosolic part of Trop2
phosphorylated cytosolic part of Trop2
SpoVM P9A mutant
TRIM25 (PRYSPRY) domain
decorin binding protein B
Uncharacterized protein
60S pre-ribosome
[GlnB22]-insulin mutant
human insulin
hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4
toxin, RhTx
RING Finger monomer
RING Finger monomer
HuR_RRM1 monomer
Arsenate Reductase
N-domain of the AAA metalloproteinase Yme1
Twinstar from Drosophila melanogastor
Human Relaxin-2
rocker tetramer
FtsH periplasmic N-domain
M2 19-49
S31N 19-49
F231L mutant ERCC1-XPF dimerization region
14-3-3 Zeta
Human FAAP20 UBZ-Ubiquitin Complex
Human FAAP20 UBZ
aSyn H50Q monomer
aSyn WT monomer
cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)
human IgG-Fc
PHD domain of Yeast YNG2
RNA duplex
UBM1 domain of human HUWE1/ARF-BP1
amyloid beta
SERA protein peptide analogue 6737
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1
protegrin-2 docked to DPC Micelles
peptide 6762
synthetic peptide 36075
S100A4dC-MPT complex
1585 Malarial Peptide
high-activity binding peptide 6505
analgesic sea anemone peptide APETx2
Malarial Peptide 6673
Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparum
1513 MSP-1 peptide
STARP peptide 20570
wrapping silk W2
putative arsenate reductase from Brucella melitensis
L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide
STARP peptide 20546
malaria short AMA-1 peptide analogue
malaria peptide 1815
YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA
Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA
Hepatitis C Virus p7
p7 protein of hepatitis C virus
De Novo Designed Peptide that Sequesters Toxic Heavy Metals
Filamin repeat 21 bound to integrin
Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA
N-terminal dopmain of NikR
Ca-bound hN-1 4-7
MLL-IBD complex
Stable Peptide Biomarker RCB-1
flpp3Sol 2
Human Shq1 CS domain
ectodomain of the B. subtilis RodZ
three-way junction from the VS ribozyme
three-way junction from the VS ribozyme
RRM1 of human LARP6
Doc48S monomer
Decorin Binding Protein A
Decorin Binding Protein A
apo FldB
DMXAA-bound mSTING dimer
holo FldB
MTAbl13, a grafted MCoTI-II
human ubiquitin conjugating enzyme Ube2w
Isolated Ring domain
DNA binding domain of sigma 54 from E.coli
httNTQ30P10K2 fibrils
Hox homeodomain
apo EL_LovR
MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1
MLKL N-terminal domain
VEEV macro domain
Kindlin-2 F2
LEDGF/p75 IBD in complex with MLL1 peptide (140-160)
P-superfamily conotoxin Bru9a cyclised with a Gly-Leu-Pro linker
P-superfamily conotoxin Gm9a cycled with a Gly-Leu-Pro linker
putative phosphoglycolate phosphatase
Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C
BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C
microcrystallized Ubiquitin in MPD
GTPase KRas-GNP:ARafRBD complex
K-Ras and membrane scaffold protein
GTPase KRas-GDP tethered to a lipid-bilayer nanodisc
circumsporozoite protein peptide
left-handed G-quadruplex
rubredoxin domain of the NO Reductase Flavorubredoxin
tRNApro:MLV Nucleocapsid Protein (1:1) Complex
pf tRNApro:MLV-Nucleocapsid (1:2) Complex
Hs2 dimer
copper binding protein in the apo form
MciZ from Bacillus subtilis
EcMazE homodimer
EcMazE homodimer
MazE-DNA binding
truncated EcMazE
rhodanese domain of YgaP
Putative uncharacterized protein BTH I2711
Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide
Fyn SH2 bound
human EpoR
CSD1-SXL-18-mer msl2 mRNA
PTPN4 PDZ-linker
MAVS CARD filament
Rad18-UBZ/ubiquitin complex
human Ca2+-loaded S100A4 cys-free mutant
High mobility group protein from Plasmodium falciparum 3D7
NESG Target OR459
UBA domain of DNA-damage-inducible 1 protein (Ddi1)
PCP7T holo form
Structure of De novo designed Protein OR457
Nucleocapsid protein p10 and RNA (68-MER)
membrane-active toxin from crab spider Heriaeus melloteei
RNA (68-MER)
Transient Collagen Triple Helix Binding to a Key Metalloproteinase
Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNA
Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNA
First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNA
most two C-terminal RNA Recognition Motif Domain of hnRNP L
Second RNA Recognition Motif Domain of hnRNP L
N terminal domain of the MuB AAA+ ATPase
cChimeraX Ca2+ bound
cChimera Ca2+ bound
Chlamydomonas reinhardtii NAB1 cold shock domain, CSD1
bacterial immunoglobulin-like domain form a surface protein of Leptospira
spider-venom peptides against the analgesics target NaV1
OMPA C-terminal domain
NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri
NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482
NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50
RP domain of MiSp
Drosophila ELF domain from FANCL
Polyglutamine binding peptide 1 (QBP1)
ROQ domain
E55Q mutant of eRF1 N-domain
Y125F mutant of eRF1 N-domain
Cysteine Deleted Protegrin-1 (CDP-1): lr10
Cysteine Deleted Protegrin-1 (CDP-1): rr11
Hypertrophic Cardiomyopathy-Related R502W Mutant
Cysteine Deleted Protegrin-1 (CDP-1): rr14
Phosphotyrosine binding domain
LysM region of the E. coli Intimin periplasmic domain
aggregative adherence fimbriae
WW3 domain of Nedd4L in complex with its HECT domain PY motif
Influenza Hemagglutinin Peptide
conotoxin Im10A
AIP-IV peptide
AIP-II peptide
AIP-III_L7A peptide
AIP-III_DL7 peptide
AIP-III_D4A peptide
Lewisx methyl glycoside
Lewis a
MDCSGCSRPG + Zn acidic
MDCSGCSRPG + Zn acidic
MDCSGCSRPG bound to Cu
Chikungunya Virus Fusion Peptide
conotoxin pu14a
conotoxin lt14a
extended upain
alpha-conotoxin ImI Cystathionine 1-3
alpha-conotoxin ImI Cystathionine 2-4
Tryptophan Zipper analogue
MccJ25 RGD
conotoxin qc16a
nociceptin Agonist
Alpha-conotoxin Vc1.2
VK22 in DPC micelles
thromboxane A2 receptor
C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor
Substance P in DMPC/CHAPS/GM1 bicelles
Substance P in DMPC/CHAPS bicelles
Substance P
alpha-conotoxin FI
Gaq-ct only
SecA fragment
15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)
SecA fragment
conotoxin ImI analogue
Substance P
Pis-1 [PG]
cis Pis-1[NkG]
trans Pis-1[NkG]
REV analogue
rsv analogue
nociceptin analogue
nociceptin analogue
nociceptin analogue
nociceptin Antagonist
Dirhodium complex
complex BK-PGG
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Cyclic Tetrapeptide 1
Model Peptide
Myelin Basic Protein
LSEAL-CaMLD complex
KIA7H tetramer
KIA7W tetramer
Insulin A-chain variant peptide
Human Insulin A-chain peptide
Human Obestatin
D-PAKKR monomer
Mu-contoxin KIIIA
Interleukin-8 C-terminal domain
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Cyclic Pseudotetrapeptide
Apelin 17
Apelin 17
Apelin 17
brome mosaic virus protein 1a
F protein
SIIIA monomer
metastin analog
PFR peptide
PFR peptide
L7P Con-T
sodium channel toxin Hd1a
LysRS Anticodon Binding Domain 72-207
protein YgaP from Escherichia coli
Kelch domain
iron-sulphur cluster
N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1
PR domain of FOG-1
MIT1 domain of a chitin synthase
Xenopus RecQ4 zinc knuckle
NPM-N (Nucleophosmin) pentamer
CnA free
B24G insulin
[AibB8,LysB28,ProB29]-insulin analogue
human HCN2 CNBD in the cAMP-unbound state
BA42 protein
potent antifungal peptide Cm-p5
Enterocin NKR-5-3B
tandem PHD fingers of CHD4
N-terminus of SOCS5
Truncated L126Z-sod1
SUMO Dimer in Complex with SIM2-3 from RNF4
Human Chemokine CCL19
Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation
N-terminal Domain of Enzyme I
tandem SH3 domain of CAP
Nrd1p CID - Trf4p NIM complex
V domain of RAGE in complex with IOR
cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP
FldA in complex with flavin
inner membrane protein YgaP
terminal Ig-like domain from Leptospira interrogans LigB
TM domain of LAMP-2A
MBD4 methyl-cytosine binding domain bound to methylated DNA
putative thioredoxin (ECH_0218) in the oxidized state
Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide bound
Dual-phosphorylated human p38 alpha MK2 334/D peptide bound
Dual-phosphorylated human p38 alpha ADP-bound
novel human tachykinin Hemokinin-1 (hHK1)
peptide ImI1
p38-0P apo
HP24stab derived from the villin headpiece subdomain
DNA dodecamer with A:C mismatch
hIFABP-oleate complex
DNA dodecamer containing the 5-hydroxycytosine
cold shock protein, TaCsp with dT7
cold shock protein, TaCsp
KDM5B PHD1 finger in complex with H3K4me0(1-10aa)
KDM5B PHD1 finger
DNA duplex
HP24wt derived from the villin headpiece subdomain
P22S mutant of N-terminal CS domain of human Shq1
EDB and specific binding aptide
phosphorylated 4E-BP2 monomer
PPIase domain of TbPar42
Thymosin alpha 1
Q4D059, a hypothetical protein from Trypanosoma cruzi
Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4
CGACTAGTCG with AIK-18/51-1
Oligonucleotide Model of the MiR-21 Pre-Element
peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13
a peptoid analogue of maculatin G15 containing cis-Nleu at position 13
transport protein m
a computational designed protein based on structure template 1cy5
YmoB. A modulator of biofilm formation
kalata B1[W23WW]
D-arm of tRNA(Met)
apo form of human glutaredoxin 5
6aJL2 Amyloidogenic Light Chain Protein
ZapA homodimer
M. tuberculosis CrgA membrane protein
AG(7-deaza)G FAPY modified duplex
AGC FAPY modified duplex Major isomer
AGT FAPY Modified duplex
a ribosomal protein
GK cecropin-like peptide
Phosphorylated Mengovirus Leader Protein
Phosphorylated Mengovirus Leader Protein
a peptoid analogue of maculatin G15 in DPC micelles
Mengovirus Leader Protein Bound to Ran GTPase
Mengovirus Leader Protein Bound to Ran GTPase
AGA modified
Unknown protein YP_001712342.1 from Acinetobacter baumannii
GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana
reduced BolA2 from Arabidopsis thaliana
PA3793 from Pseudomonas aeruginosa
alpha amylase inhibitor peptide aS1 from Allatide scholaris
alpha-amylase inhibitor peptide aS4 from Allatide scholaris
Coronavirus Envelope Proteins-1
RNase 4
ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate
eIF4G HEAT2 domain
Ptr ToxB
E. coli Trigger Factor in complex with unfolded PhoA365-471
E. coli Trigger Factor in complex with unfolded PhoA1-150
E. coli Trigger Factor in complex with unfolded PhoA220-310
New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein
antimicrobial peptide LsbB
antimicrobial peptide LsbB
reduced Jaburetox
sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor
Solution structure of a TrkAIg2 domain construct for use in drug discovery
Lasso Peptide Caulonodin V
B25-(alpha, beta)-dehydro-phenylalanine insulin
Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx
mutation G159D in troponin C bound to the anchoring region of troponin I
C-domain of troponin C bound to the anchoring region of troponin I
COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12A
a computational designed protein based on template of human erythrocytic ubiquitin
YSCUCN in a micellar complex with SDS
NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.
hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483
The dsDNA in intact bacteriophage T7
PrgK first periplasmic domain
LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis
6aJL2-R24G Amyloidogenic Light Chain Protein
hinge monomer
Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH
N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I
G-triplex truncated-TBA
fourth constant immunoglobulin domain of nurse shark IgNAR
Solution structure of the SGTA N-terminal domain
CPEB1RRM12 in complex with RNA
CPEB4RRM12 in free state
CPEB4RRM12 in complex with RNA
tandem UIMs of wild-type RAP80
E81 deletion mutant from RAP80 tandem UIMs
Z-L2LBT variant A
Heterotrimeric pre-mRNA Retention and Splicing Complex
dimeric transmembrane domain of Toll-like receptor 3
Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain
Plectin repeat domain 6
gp41 ectodomain monomer on a DPC micelle
N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)
Lactodifucotetraose (LDFT) beta anomer
M13 bacteriophage
synthetic Mamba-1 peptide
DNA (28-MER)
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase
Dimethylarginine Dimethylaminohydrolase
Calcium Bound S100P - V Domain of RAGE complex
second bromodomain of Brd4 with Di-acetylated Twist peptide
C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)
TIA-1 RRM2,3 monomer
fd bacteriophage
trimeric Skp
NLRC5 caspase recruitment domain (CARD)
peptidyl-tRNA hyrolase from Vibrio cholerae
trimeric Skp with bound tOmpA
A tetrahelical DNA fold adopted by alternating GGG and GCG tracts
HIFABP Ketorolac complex
GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'
Ig-alpha YE variant Ig-beta construct
Ig-alpha Ig-beta construct
Ig-alpha Ig-beta construct
H83A apo HasAp
Y75A apo HasAp
WT apo HasAp
Yah1 reduced
Yah1 Oxidized
Zn-binding domain of eukaryotic translation initiation factor 3, subunit G
Receiver domain of ethylene receptor ETR1
Transport protein A
Domain-Swapped GLPG
Designed Exendin-4 analogues
native split Npu DnaE intein
CDYL2 chromodomain
extracellular sensor domain of DraK histidine kinase
Neurotoxin II from snake venom Naja Oxiana
Iron-sulfur cluster binding protein from Ehrlichia chaffeensis
dimerization domain of the human polyoma, JC virus agnoprotein
soluble A 17-34 peptide
P33A mutant of non-conventional toxin WTX from Naja kaouthia
m04/gp34 mouse Cytomegalovirus Immunoevasin core domain
preQ1 Class II riboswitch from Streptococcus pneumoniae
novel venom peptide toxin from sample limited terebrid marine snail
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA
FHL2 LIM adaptor and its Interaction with Ski
oxidized dimeric form of human defensin 5
Divalent Cations at the Active Site of the Neurospora VS Ribozyme
immune signalling subunit
RRM3 intermediate state
S-linked glycopeptide sublancin 168
Zinc finger-PHD-type 1 domain_number-1
E. coli LpoB
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5
CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44
CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10
p75 transmembrane domain
Dok1 PTB domain monomer
lysine-free (K0) ubiquitin
Ms-NbGRP2 monomer
a3Y monomer
carboxyterminal domain of NusG
EcDsbA-sulfonamide complex
I-V kissing-loop interaction of the Neurospora VS ribozyme
SHB modified duplex
RHB Modified duplex
Penicillium Antifungal Protein PAF
CD79b cytosolic domain phosphorylated
CD79b cytosolic domain phosphorylated
human Mcl-1
RRM domain from C. elegans SUP-12 + GGTGTGC DNA
CD79b cytosolic domain denatured
CD79b cytosolic domain
CD79a cytosolic domain phosphorylated
CD79a cytosolic domain phosphorylated
major factor VIII binding region on von Willebrand factor
CD79a cytosolic domain
CD79a cytosolic domain
5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997
cytochrome c Y67H
Outer Membrane Protein X from E. coli
Pseudomonas aeruginosa Tps4 two-partner secretion system
CR4/5 domain of medaka telomerase RNA
EF-hand domain from sea urchin polycystin-2
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
Cyanobacterial GAF domain
protein NP_419126.1 from CAULOBACTER CRESCENTUS
hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492
circular sortase A
GA-79-MBP cs-rosetta structures
PetF monomer
DNA duplex containing N3T-ethylene-N1I
lantibiotic NAI-107
transport protein
Big domain from Leptospira interrogans
Dimethylarginine Dimethylaminohydrolase
basic-helix-loop-helix region of the transcriptional repressor HES-1
Enzymatic cyclisation of kalata B1 using sortase A
p300 Taz2:ETAD1 complex
Protein-RNA Ternary Complex
mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195
C-terminal domain of SRA1p
UBA Domain of Human NBR1
PASTA domain of PonA2
complex of calmodulin with minimal binding domain from HIV-1 matrix protein
dimer of the metal binding domain 1-16 of human amyloid beta-peptide in complex with Zinc
CEH37 Homeodomain
hman EPRS R12 repeats
WHEP repeats
G-quadruplex bound to the bisquinolinium compound Phen-DC3
Truncated EGF-A
Molecular Binding of TFF1 Estrogen Response Element
FF domain L24A mutant
alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1
Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495
computational designed dimer based on the engrailed homeodomain structure
Dvl-2 DEP
peptide derived from the membrane proximal external region of HIV-1 gp41
peptide derived from the membrane proximal external region of HIV-1 gp41
peptide derived from the trans-membrane region of HIV-1 gp41
PAP262-270 in SDS micelles
C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1
Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1
FAPP1 PH domain monomer
cactus-derived antimicrobial peptide Ep-AMP1
FRS2a PTB domain with neurotrophin receptor TrkB
Middle domain of Hsp90alpha
circular g-domain analog from the wheat metallothionein Ec-1
C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1
C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11
Domain 2 of E. coli ribosomal protein S1
Blo 1 12 CBD domain
Blo t 19, a minor dust mite allergen from Blomia tropicalis
hFKBP25 monomer
RsmZ(36-44)/RsmE(dimer) 2:1 complex
RsmZ(SL4)/RsmE(dimer) 2:1 complex
RsmZ(SL3)/RsmE(dimer) 2:1 complex
RsmZ(SL2)/RsmE(dimer) 2:1 complex
cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03
RsmZ(SL1)/RsmE(dimer) 2:1 complex
Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39
MyT1 F4F5 - DNA complex
non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex
NusE (S10) from Thermotoga maritima
mutant dimeric TM domain of VEGFR2 receptor
trimeric mutant TM domain of VEGFR2 receptor
SLED domain of Scml2
Solution structure of the Nt. GR-RBP1 RRM domain
N-terminal domain of Bilbo1 from Trypanosoma brucei
Complex Between BCL-xL and the p53 Core Domain
BCL-xL containing the alpha1-alpha2 disordered loop
BCL-xL in its p53-bound conformation
Dot1L-AF9 complex
homeodomain transcription factor Gbx1
human wild type FAPP1-PH domain
CFP10 Monomer
Human eRF1
WW Domain Strand-Swapped Dimer
WW Domain with Loop 1 Excised
Novel 4/7-Conotoxin LvIA
bacteriophage T7 encoded inhibitor (gp1.2)
Ca free domain 6 of villin
cdN dimer
WW domain with polyproline stretch (PP2WW) of HYPB
PP2WW mutant (KPP2WW) of HYPB
SVIP mutation
WW domain of HYPB
Regulatory Domain of Tyrosine Hydroxylase
RDTH dimer
RDTH dimer
Active Site Mutant Pepitdyl Carrier Protein
P130Cas SD
uninhibited ETV6 ETS domain
Sp140 PHD finger cis conformer
Sp140 PHD finger trans conformer
ShK-like immunomodulatory peptide from Ancylostoma caninum
Recombinant CR1 fragment, domains 1-2
Recombinant CR1 fragment, domains 2-3
piscidin 3 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers
piscidin 3 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers
piscidin 1 in aligned 1:1 phosphatidylethanolamine/phosphoglycerol lipid bilayers
piscidin 1 in aligned 3:1 phosphatidylcholine/phosphoglycerol lipid bilayers
putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis
ShK-like immunomodulatory peptide from Brugia malayi
BolA-like hypothetical protein RP812
dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Ubiquitin Binding with SH3 domains
murine norovirus CR6 NS1/2 protein
E7 dimer
spermine modified DNA duplex
N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA
murine norovirus NS1/2 CW3 WT
mammalian tachykinin neuropeptide gamma
murine norovirus NS1/2 D94E mutant
Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand
Cat r 1
hypothetical protein
Salmonella MgtR
bacteriophage transcription regulator complex with p7 peptide
BldD-CTD monomer
mouse RyR2 domain A
RyR2A delta exon 3
Vav1 SH2 domain complex
Nosiheptide in Complex with TipAS
Promothiocin A in Complex with TipAS
C-Ala domain of alanyl-tRNA synthetase
Rrp7 C-terminal Domain
LMO4-LIM2 in complex with DEAF-1 (404-418)
K11-linked Diubiquitin
OmpX within the trimeric chaperone Skp
tOmpA within the tirmeric chaperone Skp
Trimeric Skp with bound tOmpA
trimeric Skp with bound OmpX
trimeric Skp
K11-linked Diubiquitin
Clip-segment of the von Willebrand domain 1 of Crossveinless 2
antiparallel (2+2) G-quadruplex
The structure of the Box CD enzyme reveals regulation of rRNA methylation
EKLF(22-40)/Ubiquitin Complex
Forkhead DNA binding domain of Brugia malayi DAF-16a
FAT10 first domain
human holo-PRL-3 in complex with vanadate
human Polymerase iota UBM1-Ubiquitin Complex
Abeta Fibrils
CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly
EBNA-2 N-terminal Dimerization (END) domain
stacked dimeric G-quadruplex
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative
parallel-stranded G-quadruplex in DNA poly-G stretches
conotoxin muPIIIA-2
conotoxin muPIIIA-1
Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2
hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'
alpha7 nAChR transmembrane domain
IL10 dimer
Calmodulin, C-terminal domain
N2-dG IQ at G3 in NarI sequence
alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa
Ani s 5 Anisakis simplex allergen
calbindin D9k magnesium bound-form
calbindin D9k calcium bound-form
calbindin D9k Apo-form
Structure of Pex14 in complex with Pex5 LVxEF motif
complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA
region 2 of E. coli sigmaE
Lipid Transfer Protein from Lentil Lens Culinaris
STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains
STIM1 CC1-CC2 homodimer
Val66 BDNF Prodomain
Met66 BDNF Prodomain
acetylated aSyn A53T monomer
acetylated aSyn monomer
aSyn mouse_T53A&N87S monomer
aSyn mouse_N87S monomer
Transmembrane-cytosolic part of Trop2
C-Terminal Domain of AciniformSpidroin
aSyn A53T monomer
Temporin-1 Ta in lipopolysaccharide micelles
HIV-1 Vif SOCS-box with Elongin BC
DUSP16 Monomer
26S proteasome subunit monomer
cerato populin
RasGRP2 EF hands bound to calcium
DNA helicase RecQ
HHARI Catalytic Domain
Saccharomyces cerevisiae Est3 protein
complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside
an inhibitor bound dengue NS3 protease
an inhibitor bound dengue NS3 protease
kalata B7
(HhH)2 domain of human FAAP24
ERCC4 domain of human FAAP24
Pin1 WW domain mutant 6-1g
Pin1 WW domain variant 6-1
DNA-binding domain of T. brucei telomeric protein tbTRF
calcium-bound human S100A12
Pin1 WW domain mutant 5-1g
Pin1 WW domain mutant 5-1
NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA
BeF3 Activated Sma0114
Calcium Sensor
lymphocyte receptor NKR-P1A
d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid
Bovicin HJ50
Dictyostelium discodieum Myosin Light Chain, MlcC
CRABP1 apo
Sigma-1 receptor chaperone domain
W184AM185A mutant of the HIV-1 capsid protein
HIV capsid dimer
Pin1 WW domain
FimH -heptyl-mannose complex
FimH Y48A mutant
FimH Y48A mutant - Heptyl-mannose complex
RRM domain of HUMAN RBM7
PAI subdomain of Sleeping Beauty transposase
SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'
HisJ and Histidine
Domain 2 from E. coli HisJ
Domain 1 from E. coli HisJ
2c TCR
AhPDF1 from Arabidopsis halleri
Aha1 dimer from Colwellia psychrerythraea
two-domain RNA-binding fragment of Nrd1
PHD Domain from Human SHPRH
2'F-RNA/2'F-ANA chimeric duplex
Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601
proteasome related subunit C terminal domain
proteasome related subunit N terminal domain
Yeast Rpn9
sod2 TM IV
Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain
rhodostomin 48ARGDWN-67NPWNG mutant
rhodostomin 48ARGDWN-67NGLYG mutant
rhodostomin P48A/M52W/P53N mutant
Arginine kinase transition state analogue complex
PcCBM36 monomer
Engineered Cystine Knot Protein 2.5D
BAF155 SWIRM domain
RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1
C-terminal structure of (Y81F)-EhCaBP1
alfa-actinin from parasite Entamoeba histolytica
20S-11S proteasome-activator complex
beta-Hairpin Peptidomimetic Antibiotics
Methanothermobacter thermautotrophicus MCM C-terminus
S72-S107 peptide of 18.5 kDa MBP
calmodulin-binding domain of plant calcium-ATPase ACA2
Trp-cage 16b P12W: a Hyperstable Miniprotein
Trp-cage Circular Permutant
Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1
PTPN11 C-SH2 bound
PTPN11 C-SH2 free
calmodulin-binding domain of plant calcium-ATPase ACA8